Description :
From Genome Similarity Track
Location :
Scaffold_85:12458- 13940
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_85-snap-gene-0.11Peptidyl-prolyl cis-trans isomerase, parvulin-type

Sequence
1482 bases(100 bases per row)
GCCGCGATTATCCACGACGAGAAGGGCGGGATTTATGTGAGTGGTTGGTTCATTGGCGTAGCTGACTCAGTTGCGGCAGTTTGCGCACAATACTGATTGT
CCCGTGTTGCTGGATGTCATTGTGTGCAGATGGTGGATTTGATGTCGCGACACGGCACGTATGTCGGACGCAAGAAGATCCCGCCTCACGACCCGTATCT
GCTGCATGGTGAGGACAATGCATGCACAATTGCTCTGCGCGCATTGTGACATTCACTCACATCCATGCTGTAATGACTGGTAGAGGGCGACGTTGTCAAG
TTCGGCCAGAGCATTCGCATGTACATCTTGAAGGGCGCGTCGTCGGACGGCGGGAGCGCGGCGAAGAAGAAGTCGTGGGGTCGAGTGAAGCTGCGCGCGC
CGAAGGTGAGCATCACGGGTGTCCTGCCGAAGAAGTCGACGCGCCCGCGCATCTCTGCGCCAGTGACGAAATTGGTCAACGACGTCTGCTACGGAACGCA
ATCGGATGAGAAGATGGACACGTTCATCACCGCAGTGATGGAACTGTCCGACGACGAAAGAAAGGTACAAAGCTGCTTACTTATTCGCTACTTGTGAGGT
TATGTGCGTATGGCTTACAAATGTGGTGTGCAGGAGGTTGCTGACTTCCTGGTCGAGAAGATTCAAGCCAAGTTCGAGTTCTATGCAGCCCATGTACGTC
TCGTTTATGATTTGTTTGCAGTGCGCATGTGCGTTTGATGCTGTCTGCGTTTAATACTGATAGTGTGCATCGATTATTCTTTTACACGCAGGTGCACCGA
AATGCGTTCTTGACCACGATGAATCTGTTGAAGCAAAACCTGTGCGTTGAAGAATTCGAGTCGAATTTGGCAACGATCACGCACCTCTCCCAGCAGCGTC
ACGACAGCATTTACAGGGCAGACGCGAGAAAGGTGCTGTCTTTTTATTGTTACTGGGTTATGCATGAAAGTTATACGGGTTCTTATCATTATTATGCGAT
GCAGATTATGCAATTGATGGCCGCTGTGCGCCTGGATCCGGACAACATTCAGTATGAAGATTCGGACATGGAAGGCTCTGGAGACGATCTGAACAGTTGT
CCGCCAACTTCTAGCAACAAAGTCACCCGAGAGCGAGTGCTCAGTGATGAGGGCAAGAAGCTGTTTCTCTCGGGACACGGCATGGCTCAGCATGGGCGAC
CGGATTCGAATGAAACTGCGAGCGAATCGGGCGCACCCGTCTTGCGAAGAAACACGACTGGCGACATGGATCCACGATACGCGGAACAAGATGGTTCGTC
AAGTCGTTACGGAAGCGAATACGACGACGATGGGTCAGACACTCGATCCCAGGACGGCTACGTCCCACCGGCTCCATGGCAAAACCCACGCGCTGGACAA
GGTTATCTAGGCAATCCTCGTTACATGCAAGGCGGCTCGTCTACCAGCAACGGAACCTCAACGCGAGATGGCAACGATGGCC