Description :
From Genome Similarity Track
Location :
scaffold_14:124579- 126002
Sequence
1423 bases(100 bases per row)
CTGCCACATACCTGACTCCTCTTCAGGTGAAAATGGGGTACCAATCGCAGTGGTATCAGCTGGGTTTGCATAGTTTTGAGCTTTCGTGCTTCCCTTCCAG
GACGAAGAGGAGTCATTGCCGGATGTCGAAGATATATCCGCAGTCGCGTGTTTTGATACGAAGATGTTTGGTACAACCACTTCACGCCCGCCTTTAACAG
CAGCACTTGCTGGGTCTGACTCAGCTCCGCGGATCAGTGGCATAAGCTCACGGAGTATGGCCTCACGCTTTGCTTTACCTTTTGAAGTCATCGTATCCAG
GTCAGGGAAGGATGCAACATTTGACATTAATCTAATAGCTCGTCAACACCGTTTTGATGTTGCTTGCAGCGCTGAGTCATGTTCGGGGGCGTTCTTCGCG
CTGATGAGGGTTGTGAATAAAGGCGGAATAGTTCCCAGGACTTCGCTTTCGTCTTTAAACTCAGGACTTGAAGTTTCAGGTCTACAATCCTGTTGCACCG
ATAGCTCCTCTTCAATTGTATACTGCCGAGCGGTTGCGATTAGAGCTACAAGGGCATACGGGGGGAGGTTGACAGTGTCCCTGATGGCTTCGGACGGAAA
GTGTGGACTGTCGAGCTGTCTGATTGTTAAGGCTTCGGACAAAAGTACTTTCGGGAAACGGAACTCCAGGAAGGCAGCCAGGAGGACGATCACTTCAATT
CGAGTCCGGCGAGGAAGAGCCAACACCTCACTGAGCCATATCATCGGCATCAAACGTGCGTTTGTATATTGTCTGGAGGGAGCAAAATGGCAGTGAGAGT
TGTGCAAGGTGCACTCAGCATTGTGAAACGAAACGATAGCGTGAAGCCTTCTCAGATCAGGTGGATCGTTTGGTTGAGCAGATTTGTGAGCGATCTCAAT
CAAGCTTGCGACGCGGTTCAACTCAATGGCATCCTCCGTAGTGATCTCCGATTCTACCCACACGTCCGTGACAGAACCAAATTTGCTGTTGCCTGCCGCT
GATCGCTTAGGTTGTGTGGTTAATCCAACAACAAATGCGTCGAGCTCCTCGATCGCTAGTTGTCTTTCCGTTGACGAAATGAAGTGACCATCCAGTATCC
ATACATTTGGTAGCAGCGCTACTACTTTTTTTCGATATTGGTCGAGAGTATTCCCTTTCAACAGGCCAGCGTTTCCCAACAAGCGCACTTCCAGCAAATG
CACGTCCCGAATGCACACCAAGTCTTCAAAATTAACCCGATTTCGCTCAAGGTACAAGAAACCCAAAGCCCGAAACGATGCGAGCGCGTGGAGATCCTTC
AGCAGGTTGTCATTGAGATCGATCCGCCAGAGCTTTCTCAACTCCATGATACCTTCGAGGTCTTTGATGTGATTATTATCCGCGTACAGAGATTGCAGAC
ATTTGCATAGGTCGAGATGCTTG