Description :
From Genome Similarity Track
Location :
Scaffold_4:1245522- 1249562
Sequence
4040 bases(100 bases per row)
CACCTCAGTCAAGCCCCGCTTGACTGCATCGAAGGCCTGCTGACACTCAGCAGCCCAAACCCACTCGGCGTCCTTCTTCAGGAGCTGTGACAGCGGGCGT
ATCATGCCCGCGTAGCCCTTCACGTACTTGCACAAGTACGTGGCCAAACCAAGGAACTGCCGCAGTTCCTTGACGTTCGACGGCGTCGGCCACTCATTGA
TCACTCTGACCTTCTCAGGATCAGGGCGGACATCGTTCTTCCCGACGAGACACCCGAGTACGGGTATCTCGCTCGCCCCGAAGATGCACTTCTTCAGGTT
CGCATAGAGCTTGTGCTTGCGCATGAGCGCAAGCAGCTTCCGGAGATGCACCTTGTGTATCTCAACATCGCTCATCCCGTCCGCAGCCCGGCTGTGGACG
AACACATCGTCGAAGTAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTCACACACCTGTTGAAGGTCGCAGGGGCGTTCTTCAGACCCTGCG
GCATCACTAGTCACTCCCAGAGCATGCCGCTCGGCGTGCTCACAGCCGTGAGAGGGATATCGCTCTCACGCATGAGGATCTGATAGAACCCATCGCGCAG
ATCAAGAGCACTGTAGATAGTGCTCCTGGCCATCGAATCGATGATGACATCTTTTCGCGGTATCGGTGTCTGCGCCGGTATCGCCGCATCGTTCAGCTTG
TTGTACGCATGAACGATGCGCCAACCGCCCTGTGGCTTCTTGACACAGAACGTCGGAGCACTGTGCGGGGATTTCGATTCCCGCGCTTGTCCAGCTTTGC
GACGACTCTCAAAGAAGTCGTCGATCGCCTTGACCTGCTCTCGCGGCAGTGGCCACTGCCGCGTGACACAATACTTCGTCCCCGGCACGAGATCAATCTC
GTGCTGGATGCCCTTGTCCTGCAGAAGCTCCGCAGGAATCTCTTCCAGGAGTACGTCCGCGTACTCCCGTAAGATCTCGTAGTAGGGACTCGTCTTCAAC
GAATCCCAGCTCTGCTCTTCAAAGCGCTCCTTCTTCGTCTTCGCACTGAGAGTGTCCTCGCTCTCAGTGGTGGTCTCCATGAAGAACTGCCTCAGTTCTT
CATTCTCGCTCTTCGTTCTCTCGGCGTCCGAGAGAATGCATATTTGCTCGATGCGTCCATCATGCAAGTCACGCGCGAAGCGCTTCCAGCTCATGACTGG
AAGCGAAGTCAACTCCGACGCTTGCGTCGGAGGGTTAGCGAGAGTCATCTCCCTGTACCGGAACCCGGCGCAGGTACGCGTCAAGACGTTCAACGTCTCG
ACGTCCGGCTTCTCAGCCTCCGTCTGCCCGGTAGACATTCCTTGTAGCGTCTCGGCCCCAGGCCGAGACTTGCGCAGCGATCTTCGCATGCGCCGTCTTC
TTGTTTTGCGGAGCCCGGATCCGCTTGGTTCTTGACCTCGTCCAGGCCCAGCCGTGGACGGGTGTTCTTCTTTAGTACCGCCGGCGGGTTCATCCCGCGG
GCGAGCAACTTCAAGCCCGGCTTGGTCGCCCGGCGCTTGGTCGTGCAGCCCGGCTGCACGACAGCATGCAAGATTTTCCGGTGCGGGACGTTTGCAACCG
TCCGCACCACCTGCAGCGTCGGCTCCCGGAGCCGACACGCCATCTTCACCTCGACGCCTGTTATTGGCGGAGCCCTCCATTACGGAGGGTGCGTCGGCTC
CCCGAGCCGACGAATCAAATTCACCCAAGCCATCGACTCCCGGAGTCGACGGCGTTACGTCACCTTGGCTCTTATTATTGGCCAGACCTGATCCACTCAG
ATTCGCGTCAGCCTCCACTGCTGAGGCGTGTGACTCGCCAGCGTCATCCGTGCCCCTTGAGGCCGGAGACTCTTCCTGATTCGCTGAAAGCGGGTGTCGA
CCTCCGAGGTCAACACATTTCCTTCATTAGCTGTCGGCGGCAACGCCGACGCTAGCTGCTCTTGCGCGCGTACTCGCGCGCGCCCAGGGCGCTCCGGGAC
AGCGGTATTAGGCGCTGTCTCGAGTGGGGAGTCGCGCGCACCTGTCGGTGCGTGCGTAGCGGCAACAGGGCCATCGCTCACTGTTCCGCTGTCGCGACCG
AAGCGCACGAGAGTGCGCTTCTCCCAATCGATGACCGGATCATGCCGTGCAAGCCACGGCATGCCTAATACGATGTTAAACTTATCGTCCAGATCCAGGC
CGATAAAGGTCTCGACAAACTCTTGATCTTCATACGTGAAGCGCACGCGTACCATGCGCTTCTCGGTCTTCACGACGGCACCCGTTGCCAGTCGTACTTC
CAACATACTTCGAGGTATCTTTAAATCCTCGAAGTCAAGCCTTGATAGACTTCGCAGTCGAACAAAGTTCTTCGACGCGCCAGAATCTACCAAAGCACGG
AGAGAGCCGCTTGCTCTCATCGAGTTCACATCCAGGATGACAAGGTCAGGCTTGTCATCTTGGTTCTTGCAGTGAGAATGAACCTCACTGGGGACTGCAG
TCCTCAGTGTCGCGTGTCCAAGGTCGACACGCGGAACTGCATTACCAGTAGGGCGCCCCGCGCCTACTGGCGTCCAGCGTTTTTTGTTTGGTTGCGACGG
TGCCCGGTACCGCCGCGATAGCCACCCTGCTGGTGCACGGGGGCCGTGCACCCCCGAGCAAAGTGACCGACTCTACCGCAACGGTAGCATCGCACATTGT
TTCCCTGCGACTGCTGGGGTCCAGCAGTTGCAGCACTCGAGAGGTCCATGGTTTCTGGGCCTCCCGTCCTCACTACCGGGCGTGGCTGGGGCCTCGGCAC
ATGTGCATGCAGCTTAGCCTGCCGCAGGCTAAACTCCTCCTGCATTGCAAGAGTAATTGCAGCTTCGAGAGTACTCGGGTACTCACGGAAGAGATAGGTC
TTCACAGGCCCATCTTTCAGCCCCTTCATGAACGTGACGACCTTGGTCGCCTCGTCGATCGGATTGGTCACGATGTTCGAGACCAAGTACCGTGCTATCT
GAGCGTAAGCATGGACATCATGCTTGCCCTGCTGCAGGTCGAGGAACTCCGCCCTCGACCGGAACTCGTTTTGCGGGGGCTCAAACGCTTGTCTGAGCTC
TTTCTTGAAACCCTCGTACGTGCTAAAGCACGTAAGATCCGAGAGTCGGCGTCCATACGCCCAACTTCTTGCACGTCCGCCAAGACATGACATGGCGAAC
GCGACCTTCGACAACGGGTCGACGATGCATCGAGCCGCAATGGCAGTGTCAAGTTCGACAAGCCAACGGAGGAGAGGCTCGCCCTCTCTTCCAACGTAAT
TGCTCACGCTGAGCTTCAGCGATTGCGCGCGCGGTGTCGTCCCCGACGACACCGTGGTAGACGAAGCAGCATCTCGCTGCTCCCTCATGATGAATCCCAG
AGCAACACCATGTTGCTCTGTCGGCGTTAGCGTACGCAGCATCGTAGCTACAGCCGCCTCACCAATTACTGTTGACAGTCGTTGGAGAGCTTCCCACTCT
GGGTCCGACAGGTGGGGACAGTCAGCGCGTGCAACGTGAGTTGCAGGCGTAGTGGAGTTTTCCATGGGCACCTCTGTATCCATGGGAAGGTTCTCAGTTC
CGCGTTCGTGCGATGACGTACGAACTCAGGTAGTCGGTCGTTGGACGGACTACGAAGTGCTACCAGGTGTAGTGGGCCTACTTTGGCTCACTACTTTAGC
TTACACCTGTGCGCGTGTATGTGAGGAAGCGTCGCTTAGTTTAACTAGAGTTAATTATACTCGGGCCTCCGAGTATAGATTAATCTAAATAAACGATCCA
AATAATGTTTTTGGGTTAAAATGAGAACTGCTATTTTTGTTTTATGTTTCTGACTTCCTCTAAATGTAATATTCTAAGATAGGAATCTGCCAACGGCTGG
TTGGCAGAATTCCAATGCTATGCATGTCGCTCATTGGCTAAGAGATGCTGCTCTCAGCCAATAAGAATCATAAGTCTCTATGGACCACCCGCCGTGGTGG
TCGTAAATGTATGTAGCCTTTGGTGTGTCTACACCAAGGT