Description :
From Genome Similarity Track
Location :
Scaffold_109:124544- 125565
Transcript NameFunction/comments
g12046.t1POM81374.1 ADP-ribosylation factor GTPase-activating protein [Phytophthora palmivora var. palmivora

Sequence
1021 bases(100 bases per row)
CGCAGTGTGCCGGAGTTCATCGCTCCTTGGGCGTCCACGTGTCTTTCGTACTGAGCGTCATGCTGGACAAGTGGACGGACGACCAAGTGAAGACGATGGA
CACCATCGGCAACACGAAACTCAACCAGCAGCTTGAGCGAACGCTGTCTCTGCAGCTCCGGCTGAACGCGCAGACGCCCAAGAAACCCGAAGCGCAGACG
CCGCGTGCGGACCGTGAACGGTTCATCCGGGCCAAGTACGAGGACCGGTTGTTTTCTGGCGGGGTCAACAACTCACCACCCAAGCCGCCGTCTCCTGCCA
AACGCAGTCCCACAAAAGCTGCAGCGACGACGCAAGGTATGGTGGAGTACACGGGCGTCGTGGTGATCGACCTGAAGGAGGCCAAGGAGCTGGCAGGAAT
GAACATTAGCGGCAAGTCGGACCCGTACGTGACGTTCCGCTTGGGCGAGCAAAGTATCAGCAGCAAGCGCGTGGACAACAGCGTCACTCCTCAGTGGAAC
CAGCAGCTTATGCTCTCGTGGGATGGCACTTCCCCGCTAGAGGTGGAGCTGTACGACTACAACAAGGTCAACGCCGACCGCCCGATGGGGGCATTTGCAG
TGAGCGCGCAGCAGTTGGCGTCGCTACCCGATGCGACCGACACTGACGGTCCCTACGAAGATTGGTATCCGGTGATCATGCCGCGCGACTGGGCCACCAA
CTTCAGTGAGCACATGGTAGCAGGGGCTGAAGGTGTCACCAAGGGCATCTATCGAGGCATCACCGGCGTGTTCAAGGACCCGATCAAAGGAGCTCGCGAG
AATGGGCTCGAGGGCTTCGCTAAAGGGGTCGGCACAGGCGTCGCTGGCGTGGTCTATCGCCCCATGAAGGGGCTGGGCACGATGGTCAAGCACTCGGCTC
TTTCTGTTGGCGTCGGGAGGAAACACCGCACGAACAGCACAGGAAGCGAAGGCGAAAGCGGGAGTTCCTCGCCGGACAGTCGAGACTACGTGGCTGCGGG
GTCCGTGCGACTTGCGCTGTC