Description :
From Genome Similarity Track
Location :
contig_14:124541- 125964
Sequence
1423 bases(100 bases per row)
CTTCACGCCCGCCTTTAACAGCAGCACTTGCTGGGTCTGACTCAGCTCCGCGGATCAGTGGCATAAGCTCACGGAGTATGGCCTCACGCTTTGCTTTACC
TTTTGAAGTCATCGTATCCAGGTCAGGGAAGGATGCAACATTTGACATTAATCTAATAGCTCGTCGACACCGTTTTGATGTTGCTTGCAGCGCTGAGTCA
TGTTCGGGGCGTTCTTCGCGCTGATGAGGGTTGTGAATAAAGGCGGAATAGTTCCCAGGACTTCGCTTTCGTCTTTAAACTCAGGACTTGAAGTTTCAGG
TCTACAATCCTGTTGCACCGATAGCTCCTCTTCAATTGTATACTGCCGAGCGGTTGCGATTAGAGCTACAAGGGCATACGGGGGAGGTTGACAGTGTCCC
TGATGGCTTCGGACGGAAAGTGTGGACTGTCGAGCTGTCTGATTGTTAAGGCTTCGGACAAAAGTACTTTCGGGAAACGGAACTCCAGGAAGGCAGCCAG
GAGGACGATCACTTCAATTCGAGTCCGGCGAGGAAGAGCCAACACCTCACTGAGCCATATCATCGGCATCAAACGTGCGTTGTATATTGTCTGGAGGGAG
CAAAATGGCAGTGAGAGTTGTGCAAGGTGCACTCAGCATTGTGAAACGAAACGATAGCGTGAAGCCTTCTCAGATCAGGTGGATCGTTTGGTTGAGCAGA
TTTGTGAGCGATCTCAATCAAGCTTGCGACGCGGTTCAACTCAATGGCATCCTCCGTAGTGATCTCCGATTCTACCCACACGTCCGTGACAGAACCAAAT
TTGCTGTTGCCTGCCGCTGATCGCTTAGGTTGTGTGGTTAATCCAACAACAAATGCGTCGAGCTCCTCGATCGCTAGTTGTCTTTCCGTTGACGAAATGA
AGTGACCATCCAGTATCCATACATTTGGTAGCAGCGCTACTACTTTTTTCGATATTGGTCGAGAGTATTCCCTTTCAACAGGCCAGCGTTTCCCAACAAG
CGCACTTCCAGCAAATGCACGTCCCGAATGCACACCAAGTCTTCAAAATTAACCCGATTTCGCTCAAGGTACAAGAAACCCAAAGCCCGAAACGATGCGA
GCGCGTGGAGATCCTTCAGCAGGTTGTCATTGAGATCGATCCGCCAGAGCTTTCTCAACTCCATGATACCTTCGAGGTCTTTGATGTGATTATTATCCGC
GTACAGAGATTGCAGACATTTGCATAGGTCGAGATGCTTGATACACTCGATATCTGCACTAGATAGGTGCAATGCCAAAAGATCCGGCAATGGTGCCTTG
GCCCGCGCGCGGATCAACGCTGCGTCCGGAGATCTCATGCCAGGCGCTCAAAGACGAGGTATTTCTGAAAGTCGGCAAATGAAGCATTGCTTTATTTATC
CGCCTTCGTGGGGAAGGAGTAAA