Description :
From Genome Similarity Track
Location :
Scaffold_16:124528- 126097
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_04882malonyl-CoA decarboxylase (MCD), putative

Sequence
1569 bases(100 bases per row)
CAGACTTTGTGCCCCGCGTCGTTGTTCAGAGCATCTGCAAGGCGTACAAGTCGCTCGACTTTGACGGGAAGCGCGACTTTCAGCTGGCGCTGGCGCGGGA
CCTGCACCTCGACACGACGGCGGTAGCCCTCACCGCCTCGATGCCTTCGCGCTAAGGACCATGTAGCTTCAGCAGCAGCTGCAAGCGACCATGACCAACT
TGAAGACGGTCGCTACTGACGACGGCGCGGTCGACTGGACGCACGAGCAGCTGGAGAAATACCTGCGCTCGACACGCGCCCTGCGGGAGACGCTCACGCC
GCTGCACGAGGTGCGTGGGTCGAGGCAGGATGGCGGTGTATCAACTTGATACCTAGCTGCTTTTTCACCAAATTTTGAGCCAGCTTCCGAGCGGCATGCT
CTTTCTCGTGCAGCTCCGCGCCGACGTGCGCCAGACGCTCGCCAAGACGCACACGACGTCGGCAAAGAACGATCTCGTCGCCCTCCGCGCGCTCGACAGT
CAGCTGCAAACGTTCCTCGCAGCGTGGTTCGCGGTTGGCTTTCTCTCGCTCGAGCGTGTGACGTACGAACACTCGCCCGGCGCGCTCCTCGAAAAGATCA
TTCGCTACGAAGCCGTTCATCCCGTGGGCACGATCATCGAGCTCAAGCGCCGCCTTGGGCGCGGCCGGCGTTGCTACGCGTTTTTCCACCCGAGGTATGC
GTTTTAGTCGTATCTTTCGACTAACTACGTGTTGTGGAAACTAGTGTGCCGGACGAACCATTGGTGTTTGTGCATGTGGCACTCGTGCCCGAGATGGCGA
CGGGCATGGGCTACATCAAGGACGCGACCGAGGTCCTCGAGCACGAGCATGACGCGCACGCTGCGATCTTTTACTCGATCTCATCGACGCAGCCCGGGCT
TCAGGTTGATACTTTGATAGTTCAAAGGTGACTGAAAATAGTGTCTAGGGCGTCGACTTGGGCAACTACCTCATCAAGCAGGTCGCCAAGCGCTTGCAGG
AAGAACTCCCCAATGTATCGCTCTACTCGACGCTGAGTCCGATCCCTGGTTTCGTCAAGTGGCTTGAAATTACGGTATTTTTCGCTGTTTCCAGAAATGA
TTCAACAACGAACGACGTAGGATGCGAGCGCAGTTCAGCCGGCCGAGGCAAGTGCGTTGGCTGCCCACGGCTTTACGTCCGTCTTGGCTGCTCTCTCGGT
GCCGCAATGGCACGAAGACGCGGCGCTGACAACGCTTCTTCGCCCGATCTTGCTGCGTCTTGGCGCCCAGTACCTCTACCTCGAGAAGAAGCGCGGGAAG
GCCCTTTGCCCCGTCGCCAACTTTCATTTGCGCAACGGAGCCATCTTGGAGCGGCTCAACTGGCTCGGCGATCCGTCGCCCAAGGTAATGATGATGGATG
GTTTTAAAAATCCTTTCAAAAATGACATGCGGTACTAGGGACTGGCGCAGAGCGCGGGCCTCATGGTCAACTACAAGTACGATCTGGAGCAAGTCGAGGC
CAACAACGAAGCGTACCTGCTGCACAACACGATCGCGATCGGGGCTGCGGCGCGCGCATGCTTGGCGTA