Description :
From Genome Similarity Track
Location :
Scaffold_2:124478- 132195
Transcript NameFunction/comments
Phyci_111386chromodomain-helicase-DNA-binding protein, putative
Phyci_404032Hypothetical protein

Sequence
7717 bases(100 bases per row)
AACTGTAGCCATGTGCGATAATTCGCACTTAGACCAGTCTCTCTTCAATTCATTGAATCGCACCATACAGAGATCAAGTCAATGTCAGTTCATTGGTGTA
TACCACACAATTCCATTCCGGGTCTACCACTCGGCGCCATTCCGCGGTTCGACACCCCGCGAAGAAGAGCGCGCGCTGCCAGTCCCTGTGGCTGCCTCAT
CGCTAGCCTAGTGGACCCCAGACCCGCCGCTGTTGCTTCGTCTGCGCGTCCTCCTGTGAAATCCATGGAGAGCGGCGCCCCTGAGCCAGGTGCGTCCTCG
TAGTCCTAGAGAAACGAGTGGCAGAGGCCTCCGATGCGTTCGAGGCCTTCTGTGCAGTCACTTCCTGCGACATTATTAAGCGCAGTTCATTTCTCCTACG
TTAACTGCTACGCACTGACTTTGCTGGCACTTCGCTGTTGACGTAGCGCCAGCCTCCGCGCCGCCCAGTGAGCAGGAGACAGCCCCCGCCGCGTCTCCAG
CGCCAGCTGAGCAGAAGGTGAACGTGGCTGAGCCAGAGCCGAGCCCTGTCAGCGCTGCTACAGACGTGTCAGAGAACCAGGTGAAGGCGGAGACCCAAGT
GAAGCCCGACGGAGCTGCAGAACAAGTGAAGAGCGAAGATGGCAACCGCCGGAAGCGCCGCACGAAGAAGGTCAAGTATGTGGAGGAGGACGACGTCTCG
GAGGGTGAAGAGGCCGCCATTGCAGAGAAGAAGAAGCGCGCACAGCAGCTCGACTACCAGTTGAGGACAGTACGTGACTGTGGCTTTTCTGATGAGATGA
CTTGAAGTGGTGGTGGCTGATAATTTTATGGTGGTTATTTTTTTTCTCTTTAAGGACGTGGGCTACCCCCAGTTGGACCAAGTTGTTGGACGAAGAGTGA
ATGAGTCTACAGGACTTGTTGAGTACTTGTGCAAATTCCTGGGTCGATCTTACTTGCATCTGTACTGGCTCACGTTCGACGAGGTGGAGCTCTTTATCCC
GGAGGGGTATCAGAAGTTCCACCGCGTGCATGTGTATGATCGCAAACTGCGACGGGAAGGATATCAAGCGTTAGATGAAGTGGATGATCTAGAGGCCAAC
AAATTGACGGTGGAGAAGATTTTAAACCACAAGGTGGATCCGGCCGACCATTTGGATGAGCAAATTGAGAAACGTCGGCAACAGCTATCGTATGAGCCGA
AGTTCCCGCGTGTGACAGACTATTTCTTGATGGACAATGCCGACGCACTGCCGGAGCGCATGTTGGGCATCGTGACGAAGTTAACGAAAGAGCCGGGCGG
CGACATCTTTGAACACCCAGTTGATGTTGAGGAGGTCCCGGACTACCTGAATTTCATCACAAATCCGATGGACCTTGGAACTGTTGCTACACGGATTGGT
CGAGAAAGTTATTACATTGGACCATCGGCTACATCGTTATTTGCCTCGGATGTGCGATTGGTATTTAACAACTGCAAGACTTACAATGCAGAAGGCTCCG
ATATCTGGCGTGTTGCTGATGCGCTCCTGCGCTGTTTCGAGAAGTGGTTGTACGATTGGGTACTCACGCCTTCGGCATGGATGAAGCTCCCACCTACAGG
AGATCTGGAACAAGATCAACACCTCCAAAAGGAGTTTCGAGGAGAAGCCGAGGGCTTTTACGACGTGTGGGCACCTTGGCAAATAGGGTGTTGTGTCTGC
GGTAACAATGATCACAGCGAAGAGCTATTGTTGTGCGATCGATGCGATGGCGAGGTGCACATGCACTGTGCTACCCCAAAATTGACCGAATTGCCCGAGG
GAGAGTGGTACTGCGGATATTGTCGAGCACGTACAAAGTATGTAAAGAAGGTGGATAGTTTGAAGCAGGAAATCGCGGAGAAAAAGTCTAACATCATTGA
GGTGGTGTCTACAGGGGACGATGTCCCTTTAAACCCCACAGACGAAAAGACGGCACCTACTTCAACACATATCCCGAACATTCTTATGGAACGGGCCAAT
GGTGATGGAAAGTTTAACAAGAAAACGAAGAAACGAAGCCCAAAAGGTGCTAGCTCGACCAAAAGCTTAGCTCCGATCAGTGTGAAAGATCGCGCCGCCA
CATTTTTCTTGGTCAAGTGGGTCGGTATGTCTGTTCGTTTTTCAACCTGGGAACGTCCGGAGGATATTGGCGACGATGAACAAATCCAAAGGTATTTCAA
GTTCAGCCGCGTGCCTAGTGCTAAGGAAATCAGTGAGACTACATGTCAGTTGCCATGTTGTGCTAAACGGCACCAGTACGCTTTAGCAAACAGCACAAGC
GGCAAAAAGTGCTGCGAAAAAGACCGTTTTTGCACTCTGGGTTACGGACATGAGGGTGATTGTAGCCGAAGCATTAAAGCTCTGGGTGGGGCATACGGTA
GTACCGCTTATCAACGACTGCACATGGCAGAACAAGTGAAGGCGCAACTGTTCGCATTTCATTGTTTGTTGAACAACCACACGCCCGATAAAGATGTGCT
CAAGCAGTGTGGTGTGTACACGAACGCGTACATCACCACGAAGCAATACTTCGCACCAAAAGCTGCTAAAGATGACGAGGACGAGGATTATTCAGACGAA
GATGGCGATTCTTCCGATGACGATGCTGACTTCGACGCTGAGCTCGGCTATCCTAATCGACCCGCTCTTTACCCAGGAATCCTGACCCTGGAAAATGACG
ACGACGAGGATGACGCTGAGGGTGGAGGTCACAAGAAGAAACCAGAGGAAGAAGTTGGTGAAGTGCTTAGTTCACTCGTTGAGCATGTGGCCCTTGGATA
TCCCACGAAACTGGAAACAGTCAGTGCTGAAGTTCGCTTCGATTCTAGATATCCTGCAACCACGTTCGGTACCCTCCAGGCCTTCACTGAGTATTGCGTT
GTGCTTGGGCGATCTCCGTTCGGTCTAGGAATGCGGCTCGGCATCAGCAGCACTAACAGTGTCTCAGTGTTAGGATTCCAGCTTCTGGCGAATGGTATGA
TGGGCCCAGCTCAAGCGTCTGGCGCCATTTCGGTGAATGATGTGCTCGTTGCTGTGAACAACGTCTCGGTGGCGGGCCTTTCCTTCCAAGCCGTTGTCGG
ATTGATTAGCGCGTCTCCCAGCAGCATTCTTTTCCACTTCCACTCCCCCAGACCAGCCTTCATGTACCCTCCGTACTGCCAAGCAAAACAAGTGACGATG
ACCCGTGTGGAAGAAATCCCCGATGACGCGATTTCTGAAAATTCTAAGTACGCCAACTACAGTTACAACAAGTACAAACGGATGCTCAAAGTGGGAATTG
CAGATCCAGAGGTGGCATCATCAGCTTCAACACAAACGCTGATGCAGCACTCTAATTACATCGCACCGAGCGGACCTATGCAACACTTGTACGCGGGCGT
TGTCGACAACAGCATCGACCCTCATGAGCATTTTGCCAGCTTCCTACCAGAGCGCGGCAGCACGTCAAAGAGTGGATCGCACGGTAATGGTTCTAGTTCA
ACTGTCCATGGAGATGCGAATGAGTTTGTGCCGTATGAGCAATCGCCAACATACAAAGGTGGTCGTACTTTGCGACAGTATCAAGTTGAAGGGCTTAATT
GGATGGTTTCATGCATTAAAGCTCAACGATCGTGCATTCTGGCGGACGAAATGGGACTGGGTAAAACAGTTCAGATTGTGTCGCTGCTCGAGCATATGAA
GTCAGAGGAGTCTGTTCGCGGGCCGTATTTGATTGTTGTGCCCCTTTCCACGATCCAGCATTGGCGACGCGAGATTGAGAGCTGGACTGATCTTAACGTG
TGCGTGTATCACGATATCGGAGATCGTACCACCAAGTTTAATGCTAAAGACATGCGAGCTGTCATTCGTAATCAGGAATGGTATTATCCTGGACTGGGCA
ACTCAATTTTCAAGTTCCACATCTTGCTAACCACGTTCGAGACTATTTTGGCGGACTTCGAAGAGTTCGAACATATTCACTGGCGTCTTGTTGTGGTGGA
TGAGGCCCATCGTTTGAAGAGTGCTGGATCCCGCGTGCTAAAAATGATGCGTGTACTCCATGTGGATCGCAAGGTATTGCTTACTGGCACACCATTGCAA
AACAATACCCAGGAGCTGTGGGTCCTGCTCAATTATTTGGAACCGGTCAAATTCGCGAGCCTTGAAGAATTTAACGCGAGTTTTGGAAAACTGCATTCTC
AGGAGCAAGTTGTCAAGCTTCAGCAGTTATTGGCTCCTTACATTTTGAGGCGCGTGAAAGAAGATGTCGAGAAAAGCATCCCACCCAAAGAAGAAACGAT
TATTTCTGTGGAGCTTACAACTCTGCAGAAGCAATACTACAGAGCCATCTACGACAAAAACAAGAGCTTTTTGTACCGCGGCACAAAGAATGGCTTGCCC
ACGCTGAACAACATTCAACTGCAACTGCGAAAGTGCTGCAACCATCCATTCCTCATCAAGGGCGTTGAAGAACGAGAACTGGAGGAACTCGGTAACCACC
CAACCCCTTCTCAAGTAATGGAGAAAACGATTGAGTGCTCCGGTAAGATGATGCTTGTGTCGAAGTTGATTCCGAAGTTGAAGCGCGATGGTCACAAGAT
CTTGATTTTCAGTCAGTTTCTGAAGCAGTTAGACTTGCTGGAGCGCTACTGCGAGGCGAATTCTTTTGTCTATGAGCGATTGGACGGTTCCACTGGAGGA
AGTATGCGCCAGAGCGCAATCGATCGCTTCTCTCGCCCACACTCCAAATCTTTTGTGTTCCTTTTGAGCACGAAAGCTGGAGGCGTTGGCATCAATCTCA
TCGCTGCTGATACAGTGATTATCTTCGATAGCGACTGGAACCCCATGAATGATTTGCAGGCTCAGTCACGCTGCCACCGTATCGGTCAAAAGAAAAGCGT
GCAAATTTATCGGTTGGTGACACGCAACACGTACGAGAGCGAAATGTTTGATCGTGCTTCACGAAAGCTTGGCCTTGAACATGCGGTCCTGGGTACGGCA
TCCTTCAATGAAAATTATGACAACTCACAGACCACGAAGCCGTCAGCAGAGCAGCTTGTGGAACTGTTGAAACGGGGGGCGTACGCCCTTATGGAGGAGG
ACGATACGGCATCTAAAGAGTTTGCCGAGCGCGATATTGAGACTATTTTGAAGGAAAACGCTCGTGTCATGGTAGTAGGTGGCGGATCTAATGCGAACAA
GGGGACGGATAATGCGGGTGGACTGACGTCACCTCGACAGAGAAAGTCACCGATGAAGACAAACAAACGCAAATCACTTGGTGGAATGGCGGTAGACCGT
TCGTCTTTTGTTGCAGAGGGATCGACCGGTGAGTTATCTGTGGATGACCCCAACTTCTGGGAGAAGGTGCTCCCAGGTGCTGTGTCGGTCGAGATGCTGA
GTTTGAAGCTGGAAGATGGCAGCGCTGTCAGTTCTCGTCAGGCCAAAATTAAGTTTATTAGCAACCTGGACATTGCTCTCACCAGCTTGGTCACTGAAAT
GAGTTCTGGTAGCAGCAGTGCGGACGACGGTCGCGTGGGAATCAGAGATATCCAACACGAATATGATATTGCTATCCAGGTGCTGAGTACTGTAAGCTCA
AAGTACCGCGACGAGTTCTCCAGCGAACAGATTGATCTCGTGAAGGGATACTTGTCGAAGCTAGAAAAATCACGGGTTCGCAGCTGTCGGCTAGCGCCGC
CCAGGACGAATTTGTTCCAGGATGAGGACTTCGACACCCCGAAGAGGAAACGACGAAGGAGAAGCACACCTACGGGCAGCAGGGCGGCAAGCAGCGAGGA
CGAAGCATACGGCGATACTTCAGCAAAGAAGAGAGGGAGTAAACAGCGTGGCCGTCCTCCTAAACACCCGAGAACTGAAGGCGGGAAGCCTCCTACTGCC
CTTTTTCAGGCCGGCGCTATTAACGACAGCGACGATCTGTGCACTCTTTGTGGCGATGGCGGGTTGATTTTGCTGTGCGATGGTCCGTGTCATCGCTCAT
TCCATCTAGAGTGCGTGGGGATGAAAGACGAGCCGAACGACGAGCAGTGGTTGTGCCCGGATTGTGCAGAGGGTCGTCATATGTGCTTGATTTGCAAGCA
GGTCGGTGAAATGGGTGTCGAGTTTGGTGTCACTCAATGCTCGGTAGCCAAGTGTGGAAGATTTTACCACAAGGGCTGCCTTGCTAAGAACTCTCGCGTC
GAGTGGGTCGGCAAGAAGCGCTTTCGCTGCCCGAGTCACTTTTGCCACGCTTGCTCCCACGCCAGTAAGAAGGAATCTGCCCCCAAAAACAAGAAGAAAA
AGGATGATGTGAAGACGCACGTGGTGAGTTGCATTCACTGCTCGCAAGCTTTCCACCCGGAGTGCATTCCATCAGCGGACAAATTCATTAGGCTTTCAAA
AAACCTCATGATTTGCGCGAACCATCTCGACGGGAAAAAGCCACCACAACGTGCTGGAGGAAATTTATCTCAATCAACATCCACGCATCGGGCTGGCGCG
GCGCTTGCTGCCGCGGCAGCTCAGCAACGGTTGGAAGTTCCGCAACAGATCCCCCTCGACGAGAATGACGAGCTTGATGGAGACGCATCGACAGACAGGT
CGAGCAGCAAACGCAAGCGCACGTCATCTCCGAAAAGGGCGAGTAGCTCTGGCACGAAGAAAAACAAGTCCACTCATCCTGATGGTGTGGACAAGGTGAT
CACGAAAACGAAGATCTGCGCGTTGTGCCACCGTGGAAACGTAATGGGAGGAGGCGTGGATAGCCATGGGTCGTTGCCGGCATCGTCCTCGTCCAAAAAG
GGTGCGCGCAATGGGGGCTCAAGTGCGAGTGCTGACTCAACGGGAACTGCTACTGCTGATATGGCTTTGGAGGGACCATTTATCGAGGCCCCAGTGCGGT
TAAAATATGCGGACAAGCCCAATGAGTCTGTGTACGTTCACTTGAACTGTGCCGTACACTCACCAGAGGTGTACGTGAAAGCGGATGGACTTATCATGAA
CTTGCCGAAGGCCATCAAGCGCGGGCGTCAGCTCAAGTGCACTAGTTGCCACAAATTCGGCGCCACCGTGGGCTGCGTTGTGGCGAAATGCCGGCGCAAT
TACCACCTGCGCTGTGCCGTCGAGAGCGGCGGCGAAATTGATGGCACGACGTACGCCCTGTACTGCAAGCCGCATGCAGCTGCGCGCAAGGAGCCGACTC
GTGTGTGCGTGTGCAATGCTAGCGAGGAGGACGCGTCGCTCACGCTGGTGTGCTCCTCATGCAGCACCAAGTTTCACCCGAAGTGCGTTAACATGTCGGA
GCGCCACGCGGCTCGTATGGCAAAGACGTGGGTCTGCAGCGTCTGCGATGGGTCAGCCGCAGCGAAGCCGATGCCTCCGACCCACGTACCGGCACCTAAG
GCTAAAACTACAGTATTGAAGAAGCCCGCGGCCAATTCAGCCACGTCAAACGATTCTGCCAAGACGACTAAACCCTCGGCGACGAAGAAGAGCAACGGCG
GCAAGGCAGAGCTCAGCGACGCAACCGAGGCGCCAACCACCCCGAAGCGCAAGAAGGCGAAGAAGAACCGCCTGAGCATGCCGCGGAATAAGTCTCGACC
CAAAGCTAATGGCACGCCTCACGGGATTTCGCCGCACATGGACGCCGACTCGGATAGCGGCGTCTCCACGGACGAGTAAGTAGAGCACAGGACTGAAGAC
TCGAGCAATATATGGTA