Description :
From Genome Similarity Track
Location :
Scaffold_63:124466- 125550
Transcript NameFunction/comments
Phypa_INRA-310PPTG_17092hypothetical protein

Sequence
1084 bases(100 bases per row)
GCTGTCTTACTGCTCCTCGTGCGACTGCATCACCCCGAATCGTCTTCGATTGGTCTGGTTGCGCAAGTAGTCATGTAGCAGTGCTCCACAGTTAAGATCG
GCTTCGTCGACCCATGTCGGATCGTCGTAACCTTTCCAGTGGACCAGGAACTCGCGCAGCTTCCGTCCGTAGCGTGTTCGACGTCCTGTTCGCTCGTCCG
AGACGCGTTCGACTTCGTATTCACCCTCGTCGAGCTCAGTGTCCCAGCTGTCTTCAGGTAACAACCCTTCATCGAAGTCGAGTCGATCTTGATCTTGGAC
CCTCAATCTCACATTCGGGCAATCTGGGAATTTCCAAACCAGTTTCAGTTTGGACACATGTACCACTGGAAACACGTGATAGTCAGATCCTGCGATTTCC
AGTCGTACCGCGTGTGAGTCAACGACTTCCGCAACTCGGAACGGCCCATGCCACATATGTGCCAGTTTACGCGCATATCCCTCCTTTACACGATCTAGGT
ACAGCCATACTTGTGAACCAACCTCGATCTTGTGTGGTTGGGCCGCCTCGTTATGCCGATCTGCTCTCTCTTGAATAGCTTCGCGCAGACGTTCATTAAC
GAGCCTGATGGTAGTGTTTCTGGATATGATAACGCCACCGGCGGGGTTCTCGACGTCGAGTCGATCCTAGCGGAATCGCAGCTTCCAACGTAGTTCGGGG
ATCCCAGCCATGAACTAAGTAGAATGGCGTGTCACCACGAACACGATCTTGAGCCGTATTGAGTGCGAAAGTCAACCGTTCTGCGTATTCATCCCAATCC
TTCTGGTTTACATCAGCCACGCACATCTTGAGAGCACGTGTCAACGTCTGTACCATACGCTCTGCTGTGCCGTTAGCTTGAGGTCGATACGCCATAGTCG
CTCGCTGTTTCTGGCTGACGATCTTGTTGAACGATCTGAAGAAGTCGGACATGAAGCCAGGTTCTCGGTCATGTCTGATCGCCTCACTTGCGCCAAATCG
ACGAAACACACATTCTTCGTAGTTTTCTGCGATAGTCTGAGCAGTCCTTGAGGAGCTGGCTCTAGCGATCACGAACCCTGTGAA