Description :
From Genome Similarity Track
Location :
Scaffold_427:12446- 14652
Sequence
2206 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCCGCGGCAACGCATATGGCCTTGACGATCTCAATAAAGACGATC
TTTGACGACCCCAGTTGGCTACTACTGAGGCCATAACGGGAGGGAGTTTCGGCGCGCAGCGAATTAGCGTGTCTGCGATTGCCGAGTTAAGAAATTTCGG
GCTTCGATCACGATGGTGACCGCGCTCAAGATTGGGTACACAATGTCAGGTCTGCTTTCCTACGTGACCAATTCCCTGACCCGAAAAAGTATCTGTTTTT
TGTTGATCTGCTAATGGTACCAGCGCGAAACTGGTACTCTTAATTGAGTCGATCGACACGCACTAAGTGGAATGACTTTCTCGAGAGCTTTTTTACAAAC
ACTGTGAACTCGGCGTCTCCGCTATTAGAAAGTATTACCACGCCTGCAAGAGTGCCGATGAGACTCCGTTAGAATATCTCTATCGATTGAACGTTGCTGT
AATGCGGGCATAAAAGTTTTTACGTGAAATATGGCAATATCCCCGATCGCCGTGACCATGTGGAATATTAGATAGAAACACTGGACGATCGAGACCTCGC
GAAGCAACTAGCAATGCTTCGAGTAGATGACGTGGATACTGGAGTAAACGCTTCGTACGTACGAGCGTATGCAGAAACGTAAAGGAAACCTCCCGACCAG
CTCAAGCAAGTTCCGCTCACGATCAGCCTCACCATACACCCCAAGTCCATCTAAACCGGCCCGAGCCGTGCGTGCAATTCACGTGGGAGGCGATGGCAGT
TCTTCGGAATCAGATATAAGCGTTTCAGACTCAGAAGAAGAACAGCGACGTATTTACAGCGCTACGGCAGCCGGTCCACGACGGATTGAACAAACGAACG
TCCGACCAAGCCAAGACTGGGTGACCGCGGGCATGATCAGGATCTTGCAGAAGGACACAAGTCGTGCACTCATTGTGGGTCGAAAATACATGATGATAGT
GGATGCTAGAAACGGTTGACGTGCCAGAAGTGCGGACGCCGAGGTCACCCCTCTGACAAGTGTTTCTACGGGTGCGCAACGTGGAGGATTACACGAAGGA
GGAAATTGCCCAATGGAAAAGTTTTACAACATACTGGAATGCTTCCTTATGAAGCTGAGAAGATGTTGAACTAGGATGCTCGTCAGGTTTTAACCTGTAC
GAGCTGATCTTTCTAAGCTATGCATATATGCATTCATTATGAGAGAAGGGATTGATAATAGTGTTAATCGCCTGACGGCCAGACTTTTAGTACATGTGAT
TTGGATTCTAGCTGTTTGCCTTCAAATTGTAAGTCTGCGACGACCGGTTGAATACGCACGAACACCCACCAAGATGGAACTGAAGTTGTCCTCTGGCGAA
TCACGCTGTTACTTAAAGTATCATACTCCAAACAAGTGGTTCAGGCAAGCCAAGGCACTGGGAAATCAACAATGAAAAGGTCACCCTGTTTGACTCGAAA
GCCGAAGTCTCGATCATCGACACCACCATTGCTCGTAAGGTTGCCTGTGTCATTGGTGAGGGTCAGAAGCAAGAATGTGTGGGTATTGGAGAGAATTCAT
ACATGGCCGAAGGCCGCACGAAGGTGAAGATCACTCTGAACGGGTCAATAGCCTACTACTTTGATGTATAGATTGGTGACCAAGTGGGAGAAGAAGCATT
TCTAGGATTGGACTTTATGGTACCAGACGAGATACGCCTTGACCTGGCGGACGAGACAGTTTTTTTGCCGGACGAAGTCAGAATTCAACTGGAAGGTAGA
AGATCACCGTATGAGGCGAAGATACAACTAATTGCCGCTTATGAGAAGTACTTGGCAATACCGGTGGGTTATTCCGTAGAAGTCAATGTTGGTCGGGACC
ACTGAA