Description :
From Genome Similarity Track
Location :
Scaffold_580:12445- 13451
Transcript NameFunction/comments
g16012.t1hypothetical protein

Sequence
1006 bases(100 bases per row)
GACTTCATGGTGCCAGCTGGTATTCGCCTCGATCTGGCTGGCGGATCGATAAATCTTCCAGACGAGGTGCGGATTCAGCTAGCCGGCCGACGTCATCTCT
ACGGAGAGAAGGTCACGCAGGTCAAGCTCGGAGAGCATTGCCAGCTGGAAGGCGGAGAGTCGATCGAGATTCGGAAGGGATTCATCTTGTCAAGCCACAG
GAAGCTGTGTGTTACTCGAGGAGAAAGATGGGTACCGAGTCTGGTGACTGGGTTGGGGAAAACTTGCTATCTGAAGATCACGAACATCAGCGATCAAAAG
TTAGTATTGCAAGACGATACCCACGTTGGCATGTGGCTTGAAGGAGGACGCGTACTTCGCACTCCCGGTTTCGTGTTACCTGGATCGCGCAGGTATGCCG
AGTGACAGAATCTGGCTTTCCAGTCCACTACAGACCGTGTGGAGGTAGAAGAACCCGAACTCGCTCCTGCCGGACCCATGGTAGATCGACCTCAGTACGA
CACACCGAGGAAAATCCTGCGCCGTGACTGTGAAACCTCGAGGTCGGTCGTCGCACGACTAACCGTGCCTCGACCCGCCGAGATGAAATCAGAAACTGAG
GGATCTCCAAGGGATCAGGAAGTTGACGCCAGCGATCAGGCCGCGAGAGAATCTCCACCGATTGAGCAGGCAACACGAAGCGAGATGACTGCTGACCAGA
AGGAGTCTGTGCCCCGGGCCGAAACGCCTCCGATCGTTGATCCGGAACCGCTGGATGACGAAGAAGTATGTTACCACGAAGGTGGCGACCTGTTCGCGGA
AGATGTGGAAAGACAGATGGCAATCTTGCCGGAAGTAGTGACCATCATCGATGAAGTCACGATCGAGGATATCCAGGTGGGCGATCCTGAGTCAAACACC
CCGGAAGAAATGGATCGCCTGCGACAGATAATTTGGAGGCGGAAACATCTCCTGATCGGGAAAAGAAACGCGTTGCCACCAGATGCCGTTGGCGCAGTCT
GCGACA