Description :
From Genome Similarity Track
Location :
Scaffold_194:1244- 3794
Transcript NameFunction/comments
Phyag_g3307hypothetical protein

Sequence
2550 bases(100 bases per row)
TCAAAAATTAAATTTTGTATGGTAAGGCCCGTTCTCACATGTAAAACTGAAGCTTCAACGCATGCCAATCAAAGTGTAAAGTGGTTCATGCGTGCGAATT
ACGCTGCGGGCTTAACAAGCAAATGGCATGAACATAGCCTCAATTTCAACAAAAAGAATCACATGCAAATCGGAtaaggaaggaaattgagttgatttTC
CCAGGCATCTTCAAACTGGGCGCTCCCACAAAAGGTATCAACTGGGTGCTCCTAAAATACTGGGCATTCACGTTTGTATATAAAAATGTATGGGTGCCAA
CAATTAAGTtcgtaggttcgtgtagaacagcttaggacggaggccgtgatgctattcgggtagccacggacatctatgtagaggcaactacgttaggagc
aCTGACATCACTTCTTTCAGATAGTAACATATCTATTTTCGGGAAGGGCAAAAGTACTACTTCTTTAAGCCGTATTAATACGACATCATTCGGCTACGAG
TCAACTAGACGCTGTTAGCAAGACGCTGTATTTATGTGCATTGGCGAGGACCACTTCGTATTTCTACGATGTGATCCAAAGGCGACTAAGCGGAGGGCTT
CGAGCGGAGCAGTTTAACGTACGCATTGAGCAAGTACCTCGAGTCTGCCGCCCCTGcctgcttgagcacgttCGAGATATCTGCTGGCGTTTTCTGCATC
TGCGCCCATTTGCCGAGGAGCAAGCCTTCAACGTACGTACCCATGTACTTCGATTCCTTGGACTGCTTTGCCGAAACGAGCATCCGTACCAGTGCCTCGT
TGCTGTAATTGTCTGTCAAAGAGTCGATCAAGCTCGCCTTCCTTGCGTACGGGTTCTCCTCCCTGAACGTTCTGAAGTATTTAACCTAGGTCTTCACTTG
CGGGTTGGCAAGGAGATCATCCACTCCCTTGTCCagcatgagcttcttgaagacATCTTGCGGGGACTCGAGGTTGCGCAACCACGTcgaaatctgctgc
ttctgcaatTCGGTAGTCAACGCCTTCGTGTTTGGCGCTTTTTCTGCCGCAATGAAGAGTTGGGACAACACCGTCTCTGGATAATGTTTCTGCAGGGTAG
CGAAGAGTGTCGTTGGTTCACCGGGGTTGAACTCATCCGCGTATCTGATCCAAATCTTCAGTAGTGGACTTTCAAGCAGATTGTCCACATCCTTATCAAG
CCTGAATATCTTGAAGATCTCGTCGGTGGTGAGGCCTGCCTTGTTCCAGGACTCGAACCGCTCTGTCTCCGAGATCTTGGCGGCTGTACTGGTACCTCCT
ATCCGCACCATTTTCGCCAGAGCGTCTTTGATATTGGTTGTCAGCTTTTCAAGCCTAGAGTTGCCCCTAACATTGATCATCCTctcttctgcgtcgtcat
cgaacTCGTCGGCTCTTAGAaacctcgtcgtcgcgacGGAGCGGGGTGAAAAGTTGCGAGGAGTTGTCCATTTCGAGTCTTTTTAAGCCATTGACGTAGC
GTTGACACTTGCGAACACGGCTGCGGCGCCCAGCAATACGATGTAATGGAGACGCATATTAATTCAAAATGAGAGTGAACACAATGGCAACTTGAGTGGT
AGGGAGCGAATTGCGAAGTGGGCTGGAAAGTGGTTGCGTCATTGACTGTTGTACGAATTTCGCACGGAATATTCATCACAGGATGGGATCACAGGACTGG
CATTCTTTCCCGGCTGCTCTAATGGCTACTGCAACATTGAGAGGAGTACTGGTACAAAGCTTGCCAGGTTGCACGCTAGAGTACATAATATGTACTCTAG
CGAGTAACGTAATCAGTTGTGTAGCAGTGATCCATATTATGGATCCAATGACAATTTTGTTGTCACTGGTCATACGGATCCAATGGCAATTCAGTTGTCA
TCGGATCCGTATGTATATCCAGTGGTTGGCATACCAACAGCTAGGTACGTTGAACACCCCAGCCTCGATTTCGTGCTCACCGTTTTCTGCGTGCGCACGT
TCGACTCATCATCACCAACCGTACTCAAATTCGGGGTGATCTTTATGGTAGAGTGGTGaggccccctggtggtccagcggtctacggaccacaaagctac
gcacttggcaggCGTTCGAGGACTTTTCCAATCCAGATTATAAGAAATGAGTAGCATTCCAATAtccattcaaacaaatcagaatcaaatcaaaaaCCAT
CAGAAATCAATAGCCAAGCCAGTGAGTAGCAATCAGgaataaccagttaatcaactcaatttccttccttccttccttcctgaTACAAAAACACGAAGGT
GATCCTTGACTACGGTGACTACTTCAAGATTCATGTTGGTACGGTTTAGGTAAATCAACACCACGTTCCCCTTTTAAGGAAATTGAGAAACGTTACCTTT
GGAATTGACTTTCACCGAAGTTGGCGAGTATCGACGCTCTTAACAACCTGGAGTGGGTAAGAAGGACCCATGTGAGTTGTTATTCGTAAAATTGGTCGAA
CAGCATGGTGACCGCGTGATAGTTGATGCAATAACTGCAGCGAAAAATAG