Description :
From Genome Similarity Track
Location :
Scaffold_245:12438- 15542
Sequence
3104 bases(100 bases per row)
GTAGTTACGTTCAGCCGGTTGCAGCTGACGTGACAGATAGCAGAAGACACGTTCAGCACCGTCTGTGTCGTACTGCATTAGTGCACATCCGATGGCAAAA
TCACATGCATCGCAGACCACATGAAATGGTCTGTCTTGGTCTGCAATCGCCAAAACTAGCGAGCGTATCAAGATTCGCTTGATACCTTCGAAAGAGCGCT
GACAATCAGCACTCCATGTCCACTTCTCGTTCTTTTTCAATAAACGAGAGAGATGTACAGTCATCTCAGCATAATTGTGCGAGTATTTGTGCAAATACGC
CGCTAGGCCAAGGAACTTTTGAAGTCCTTTTATATCGGTAGGCACCGAACAGTCAGTGATCGCCTTGATCTTTTCTGGATCGGGCCGGACGCCGTGCTTA
CCCACGATGAATCCAAGAAGTGGTATTTCGCTTGCAGCAAATATACACTTCTTGAGGTTGGTATACAACTTATACTCACGCATCAGTCTAAGAACTTTCC
GGACGTGGAGTCGGTGGACTTCCAAATCCGCCTGTCCATCCATAGCCCGGCTATGGAAGAACACGTCATCGAAATAGCTGGGTGCGAAGTCTCTCAAAGA
TCTCAACAGATTCGTAACACATCTGTTGAACGTAGCTGGGGCATTGCTCAGCCCTTGTGGCAATACTAGCCACTCCCAAAGCATACCGCTTGGGGTGCTC
ACTGCTGTGTACGGAATGTCATTTCACGCATAAGGATCTGATAGAACCCGTCCATCAGATCCATCGATGAAAAGATGGTACTCCTTGACATACCATCGAT
AATGACATCCTTTCTTGGTATCGGCGTTTGAGCCGGTACAGTGGCAGCATTCAACTTGTTGAAGGAATGTACTATCCGCCATCCTCCTGTGGCCTTTCGG
AAACAGAAGGTCGGAGAGCTATGTGGGGAAGTAGATTCCCTCACATGGCCCGCTGCCAAGCGGTCGGCAAAGAATTTGTCAATCGCTAGTACTTGTTCAC
GAGGCAATGGCCATTGCTTCATGACACAGTACTTTGACCTAGTTTCAGGTCTATCTCGTGACGAGTACCCTTATCCTTGGGTAGCTCGCACGGCACTGTT
TCTGGGAACACATCTCTGAATTCCGTTAAATCATCGTAGAGAGGATTTGTCTTGAGCGATTCCCACGATTGGGATGTGTATCTCTCAATCCGAGTCTTCT
CATTAAGGACACTCTCGTCCATTGATGAGCTGCTGAGAACCCTTTCATTCTCAGCGAACACCATTGCCGACCGAATATCGGTTACGTACTCGTCTTCCGC
GACGAGTACGCAAATCTGCTCGACTTTGCCACTACGCATATCACGCAAGAACCTTTTCTGTTCGAGCGTGGGAAATTGAATGATCTCCGAAGTTGTCTTC
GGAGGCGCGATCAGATCAAGTTGGTGTGTTTCTATGCTTGATCCGTCATTGACTAGGACATTTAATGTCTCTGTTGTCTCCTGAGAACTTATTTCCACAG
TTGGGCGGGGACTTATTCCCTCACTAGCCTCTTTGGCTATCTCATCATTTGACACGAGTGGAATTGATCCCTCGTTATCCTCTGGTGGTGGTTGCGCTAC
CGCGGCCAGGTCTTCTACGTGCGATTATCTAATCGCACTAAGATCATCGTATTGCCAATCATCGGCAATCGGTTCGTTGCTACTTGGGTGTTGTCCGTTT
GGAGGACACCCATGCAGTCGCCGAAATCTGGCTCCATGGTGTGGCGATCAGCCACGTCATGGCCATGTGCAGTCGTACTAACGACCGAACCACACGCGAG
GCCATCGCACTCGCTCATAGTACACCCACTTGATAGTGGGCGCTCCATGGCGTTCATCAGATGGCCATCTGATGAACAAGTGACAGGCATATCGACTGTT
CATCGATGCCAGCTGACTTGTGACTCGTACCTGCTGAGCCACGGCAGTCCGAGGATGACATCAAATTTGTCATCCAAGTCTAATATGATGAAGTCATCAT
CGTATTGGACTCCTTTAGTGTATAGGTAATACCCACTACACGTTTCATCACTGTTACGGATGCGCCTGTCGCGAGGCGCACCGTCATTCTCGTTGGAGGG
ATCTCTCGCTCGATATATTTGAGCTCGCTGTTGTCTAGCGATTGGCGTCGTACAAAGTTGTTCGACGCCCCACAGTCAACTAGAGCTCGAAGCGACATGT
TTCGTGTCACTTCGAGTTTCAAAGTAATGAGAGAAACCTCATTACCAGAAGCAGCAACACACAATGACTGAGTGTTGGGAGCAACTTTCGTCAAGAGGCC
TGCAAACTCACTTGACGTTGCTGGATCAGTAGGGTGCTCCGCACCTACTGACCCTGTCCGTTACGTTGTTGCGTTTGCACAACAACGTCGGACCCACGCC
TTGGACCTCGTTTGGCCGCTTGGCGTTTACTGTTTCCTGCGGTACGTGGTACCGCGCTCGGGGCACTGCATTCATATGCATAATGCCCTGTCTTCTGACA
TCTATTGCAGTTCTGCAATTTCGTATAGTTATAAACACGAGAGCTCTCGCTCCTCGCGTGAAAGAGGTCCATTGGTTCTGGGCCTCCATTTTCCTATCGA
CTCGATGGACGATAGGAATTCGAATTCGCGTGAGCCTGTTTCGCGCTGAATTCCTCCTGTTCCGCAACCCTTATTGCCTCTTCTAGGGTGTTGAACTCCA
ATCGGAACAGGTAGGTTTTAACAGGACCATCAGTCAGACCCTGCATGAACAACGTAATCAACGTTTGTTGGTTCAGTGGGTCGACTGTTATGCAACTGGT
AAGGTGACGTATGTACTGAATGTACGAGTGTACCTTGCTTTATTCTCAGGAGTTTAGAGCGAGCCCTGAACTCCGCTCGAGGCGGCTCATAAGTCTGCCT
TAGAAGGGACTTGAAGACTTCCAACGACCCAAATACATATGGGTCGTGTAACTTAAGACCCAGGGCCCACGTCTTTGCACGCACTGCCAAGTTCGACTGA
GCGAATGCGATCTGCATTTGCTCATCGACGGTATGACAAGCCTGTATGGCATCTTCTAGTTCCACGAACCATCTCAATAGAGAGTCTTCATCGGCTCCCT
TGTA