Description :
From Genome Similarity Track
Location :
Scaffold_72:124369- 126768
Transcript NameFunction/comments
g13617.t1hypothetical protein

Sequence
2399 bases(100 bases per row)
GTTAAACCTACGGAAGAAGCCCCCTTCCAGTCCCTTTGCTTGACCAGATTCGTGAACACACAGCACTGGCCGTTGACCATGTTTGTCGGCCCCCGAGAAA
TGGTCATCGCGTTTGCAACTGGAGAGGTGGTCACGGCGAACGGACAGCGCTTCGGCTACGAATTTATTCTATCGGTTCCGCTGCTCAAGAAGAAAGCTAA
CGAGTCAGAGATGCCACGTACACAAATGTTGGAGACGCGCGTTTTCTGGGAGCGGCCGGATGGATCCGTGGGTATGTACAGCAAACTCATCGTGGACATC
AGAAATCGCCTCCCGGAGTCAATGAAGCAAGGGATGCTTTGCCGCGGAGTCATGCGCTTCTGGAAGTTCATACCTCGTTGCGTGGAGACGAAGAAGTTGC
GGTGGTGCTTGAAGTACAAGAAGGCATTGTCTTGTGTTCTCCAGAATCAGCCTCAAGTGCTAGGCGGGCCTGCAAGCTGTGGTGGATGCGGTGCCAGGAC
GCTGAAGTTCGCAAATACGGGGGATGGAAACTTGAAAAAGCGCGGTGGCAATCGCTGCGAACTCTGCGACGTGTGGCTATGCTTGAAGTCTTCATGCCGA
GCATCCTGCCAGGTCACGGTGGTGCTCAGTCACGGGACTGACATATTTGAGAAGGAGATAGCTCTGTGTCCGCGTTGTATTTCGTTCTCGGGGAATCAAA
GTGCGGCAAATATCGCGCGATCGGAGCTGTTAGAGACTCGGCACGTATCTCGAGGTCGTGTGGACCAGCAAGTGTGACCAAGAAATGAAATTAAGCCGTA
CTTTTCTCGCTTCCATCTTGGTTACGCTGTAGTGGGAGTGCCATATCTCCCAAAGGCGTTTTATCCTGTATGCCAGTACAGCAGACACTGCATCTCGGCT
TGAGATTTACGGCTTCCCTGCTACGTGTATTAGTGTGAAATTGTCCAATTTGAAGTTGTAAAATCAGTCATCGCGTTGCACTAGAGCAAACAATCGAATC
AATAAACAGCATCGTCTTCTATTGTCCGGCGATTGAGCTGCCATCGTTCGTCAGCCTTGGCACGACCGGGCCACCCGTCGTAGCCCCGACAAACAACATC
TCAAGAAATATGAGGACTGCGATTATTTCGTTGGAAGAAACGAGCCCGCGTTCCTATGCTCTTCCTCAGTGACACATGAGGTGTCTTGTCTGTAGATGAA
CCGTAGCTAGGATTGCTGGCTACGGCGCAGCAAGAGAAACCCCACCGATGTCTCGCCAAACAGCAATATCCAACAAACAATACGCGCTTCGAAAGGTGTC
TACCATGTCGAGCCTGAGTGCTTCCAAGTTCTGTCTTGAACTCATCGGCTGCAATGAAACACGTTGATGATGTTCGTCTTGCATTGAGCCTTGCGTTGGG
CTGGATCTGCTTAACAACGTAGCGGCGGTCACAAGCTTTTCTCTAGCAAACTTCAAATCCCCTTCTTGCCTTCCCGTCAGATCGAGCAAAAGCTGTTGCC
TTTCGGACCTCGTCCACTTCGTCATTCCCCAGCTTGCCACGAGTTCGAGTGGACGTCGTCGAAATGCAAAGGCTGTCACCCGAAGATCGAGAGCATTGCC
AAGACCTCACCACTCAACTGCTCGACCGAATTCTCTACGACTGCGATGATCTCGGATTAGAAACTGGTTGTCACGCACACCTGGATAGCCGGCGATGGAA
GAAGCTCCAGACGCACACGGACGTCACATTGTACGCTGACCGGGGCCCCAATGCCGCGTGGCTTCCGGTGATGAGTCGGGAGATTTGGGAAAACCCCGTT
GCAGTGGTGGCTGTGGGTGAGTTGAAGTGCTCGCTGGATGACGTACTACTGGCGGTCATGACGCCTGACGTTGCAGCTCAAAGACTGAGGAGTGAACTCA
TGGGTCGACGGTCCGAGACGAATTGCCGGCACGACTCGATCGTGAGACCAACTCAAGCAGCCCCTTTCCAATCGCTTGTGGTAACCCGGTTCGTGAACAC
CCATCACTGGCCATTCACCATGTTCGTGGGGCCTCGAGAGATGGTACTCGCGCATGCCTCGGGCGAAGTGGCCTCTGCAAACGGGAGACGTTGCGGCTAC
GAGCTTATTCAGTCGGTTGTGCTACGGGACAAGTACCCTCTATCCAAGTCATTGCCCCGATCCCGAATGGTGAAGGCGCGGGTTTTCTATGAGCAACCGG
ACGGGTCTGTGGTCGTCTACAACAAACTCATTGTGGACGCGAAATCCCGTCTACCCGACGCAGTGAAGCAGGGAATGCTCTGTCGAGCCATCATGACGTT
CTGGAAGTTTGTGCCGCGCTCTGTGGAGATGAAAAAGCTGCGGTGGTGCATCAAGAACAAAAAGTCCTTCGTCCGCACGCTTCAGGCTTCGTCGTATTT