Description :
From Genome Similarity Track
Location :
contig_73:124358- 127308
Transcript NameFunction/comments
g9944.t1hypothetical protein PHYSODRAFT_303338
g9945.t1hypothetical protein

Sequence
2950 bases(100 bases per row)
CGAGACCACCAGTCTGTCGTAGGCCTTGGCCGCGTCCGTGGGCGTCCAGAAGTCGCCGCCCACGATCACGCGGCCGCCCACCTCGAGTTCGGCGCTGTAC
TTCTTGATCTTGGCGGCGTTGAAGCGCACGCCCAGGAACTCGTTGGCCGCCTCGTTCTCCGTCTCGGCCACATGCACGTCCTCCACGTTGCAGCTCTTGG
TGATGGCGCGCAGTGCCGACGTCTGCAGCGGACGCGCGAGAGCGACACCGTTGACGGCCATCTGCCGAGCCGCTTGTCGGCCGAGCGGCACTTGGCTCTG
TAGTCGAAGCACGCGGTGCAGAAGCTGGGGGTGCATGTCAGCTGTAGCGGGGCTACACATTCGGTTCACCTCCTACCTTAGTGCAACATGCACTAAGGCA
TACATTCAGGTGACCACCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAGTAACACCTTTCTACCAATGAGAGTCATTCAATAGA
TAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTACCACC
AAAGCTTCCGTTTGGTTCATTTATCTAGGTTTAAGTATACTTGTGGATACAAGTATACTGAACTTAAGTAAATTACTCCTACGCTCCTACACGTGCGCAC
ACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACACCTGGTAGCACTTTGTAGTCCGTCCAACGACCGACTAACACGTTCGTATGGAATACGAA
CGCGGGCTGAGAACCTGCCCTCGGACAGTAACATGTCCGTGGGTAGCCCAAACACGTCTGCAACGCATGTTGCGCGTGCAGACTGCCCCCACCTGTCGGA
ACCAGAGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGGGAAGCGGCGGTAGCAACGATGTTGCGAACGCTATCACCGACGGAGCAACACGGTGTT
GCTCTGGGTTTCATCGTGAAGGAACAGCGTGAAACCGCTGCTCGAACTTCGGTGTCGCCATCGGCCACACCGCGCGTGGAGTCATTAAAACTCCACGTAA
GCAGCTACGTTGGAAGAGAGGGCGAACCTCTCCTCCGTTGGCTTGTCGAGGTCGACACTGCCATTACGGCTCGACGTATCGTCGACCCGTTGTCGAAGGT
TGCGTTCGCCATGTCATGTCTTGGCGGACGAGCGAGGAGTTGGGCGTACGGACGCCGACTCACAGATCCTACGTGCTTTAGCACGTACGAAGAGTTCAAG
GAGGAGCTCAAACTAGCGTTTGAGCCCCCGCAAAACGAGTTCCGATCGAGGGCGGAGTTCCTCGATCTGCAACAGGGCAAGCATGACGTGCATGCTTACG
CCCAAAGACACGGTACTTGGTCTCGAACATCGTGACCAACCCGATTGACGAGGCGACAAAGGTCGTCACGTTCATGAAGGGCCTTAGAGATGGGCCTGTG
AAGACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTTGCAATGCAAGAAGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGA
ACGCCCCACGGCTAATGCCACGACCGGTGGCAAGGCCGTCGGGAGGTGTAATGGGGCCACGCTGGCCTACACCGTTGCCGAGCAAAAGAACTTGTGAAAG
GGGGAGACCCATTGTTCTTCGGTGTGGTTCACACTGGTCACCTTAAGTACGAGTACGTACTTCACACGAATTGGTGTGTGGCACTCGGCAGCACGTTAAG
TACGATGGTGTACATCACACTAGGCACGGAGTCGGACTTACCGTAGCGGATCAAATGGGGGCCACCCATTTGGAAGATCGTCAGTTTAGACAGGAGTTCA
GTATGCAGATAGTTTACAGTAGTTAGAACCTTACAAGTGAGATTAATACAGACAGTTTAACTCTAACCTGGAAGTTCGCAAGTCGTTTGGTACTCGGTAC
CCGGAAACGACTGGAAGGCAAGCTTACAACAGAGACGCCAGGCGTCTGTTGTGGTTAGCGCGTTAACGCTTCCTCTAAGGCTAAGGTGCGTGTGACCCCC
GTCACACCTGGTAGCACTTGTAGTCACTCCCGCGACCGGCGCGGATCGCTACAATCAAGATCTCTCTGAGGATGGAAGACTCAGAGAGCAGGCTGCCGTC
CCGGCAGGATTTTCCTCATCTTTCAGATGCCCACTGGGCTACGCTAGAAAAGATGGTCAGTCTCCTGGGCGAAGCAGCGTTTGCTGGATTCCCCAACCTC
CCTGCAGAGCAGCAGAGGTCACGCGTGGAACGCTTCGACAAGTACGAATCGTCGCTGATTGCTCACGTGAGTACTGCAGCACAGGAAGCTGCTCGCACGG
CGATGCGAGCTGAGGCGCAGAGTGTGGCGCAGGCGAACCCCTCGGGTCCTGCTTCATACGCCGCACGGCAAGGAACTACGAAGCCCGTCAGGATGTCGGT
ACCGACGTTCGACGGCAAAGAAGCAGACAGTCTTGTCTTCTGGATTCGTGAGATCGAGATAGCGCTGAGCGCTGGGCAGATCTACGAGTCAAGAGCCCAA
GTTGCCTTCGCGCTTTCCAATCTGGGAGGGCGTGCACGCGCATGGGCGATGGCACGAGAGACTTCGTCTCCGGGTATTTCACCTCGTGGGCGTTCATGGA
ACAAGAACTGCGTTCGACTTTCCTCCTGGCCAATGTGGCCTACCGTTACCGGTCACTCTTTTTGCGGTGCAAGCAAGGAAAGCGCACGCTTCAAGACTAT
GTCATGGAGCTGCAGAATCTCGAAGCTGCCATGGCAGGTGCTCCCCTCTCTGAGGACGTTAAGGTGACGGTCTTCATGGATGGCGTCCGTCCGGGCCCGG
TTCGGACTGAGCTCTTCCGCAGACAGCCAACGACGTTCAACGATGCCGTG