Description :
From Genome Similarity Track
Location :
Scaffold_355:12435- 13872
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_355-snap-gene-0.23Regulator of chromosome condensation (RCC1)

Sequence
1437 bases(100 bases per row)
GGTCCATCGCGAGACCACCACCGACGCCCAACTGGTTGTCTACATCATATGGACGCATACGTACATAAGAGATGCCAAAGTGAGCCCATCAACTCTGACT
ATCTGCGCGACAAAGGACACGCATACGTACGGCTGTTGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTTAATGCGAA
CGTGAAGTCGCGGCCTGCAGAAATCGCAACGACGTTCTCGTCCGAGAAAAACTCGATCGGCTCGGGGATCTCAAACGTGTCGGTCTCGCCGTTGCCTAGA
CGACCGTACTCGCCGTTGCCCCAGGCCCAGATCTCGCCGTCCTTCGACAGTGCAACTGTGTGGAGCTCGCCACACTCGACTGACGCGATCGGCACGCCCT
GGTCCACGAGCGCGCGCACGAGACGCGGCGTAGGCTCGTCCTTACCACCGGCATGGCCCAGGCCACCGGCGCCCTTCATCTNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTGCGGCCGTGTAGTAGTCACCGCACGAAATGTCCACGATCTCAATGCCTTCAAACGCTTCCATA
AGATGCGGCAAGCTCTCGAACTCGCCCGTGCCTGGACCCAGACCCAGCTTGTTGTATTCGTTCGAGCCCCACGTGTACACGCGGCCCTTGTCGTCGACTG
CCATAATAGTCAAGGTACAAACGCATTAGCTTCTACGTTACTGCAACAGAGAGCTCACCAGTATGACAAAAACAAAGGCAAACGTACTCGCAGCGCTGTG
CGTGGCGCCAAACTCGAGCTTGACGATGCTCTTGCCTTCAAACGCCTCGAGGCGCTTCGGCGACAGCTCTTCGTACGCATTGCGGATACCCGATTTGACG
AACGCGCCATGACCGAGCTGACCGAGCGATCCAGACCCCCAAGTGTACACTGCATATGGTCATAGACAACCATAACGCAAACACACGTAAGCAATCATGT
CAATCCGTGCACATGCCCATCCAACTGGGACGAAGACGCACTGCGTAACCTGTTCAAGCACAGAGCGCAAGAGAAAAAGGAACGCACATACCGCTGGACT
GTGTAGAGAAGCGCGCGTGGGTGAGCACGGCGCGGATTGCGCTGCGCTGCGTGGCAGCGGCCGTGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCGCGTTCTTTGTTACTGGGCGGGAGACGTCCTATCGGCCGCGCGCGTTCAAGCGACCTTCGCGCAA
CGTTCTTAAATACAATCCATTTTTCAGCCAATCATAGTGCTTGAAATCCACTATAGTGTCGTAGACTCCCATTATAGTGACACTATGTTTGTGTCTACAA
AGTGACTATTTGCATGAAAATGATCACGACGGGCAAT