Description :
From Genome Similarity Track
Location :
Scaffold_11:124335- 161501
Transcript NameFunction/comments
Phymu_g862DEAD/DEAH box RNA helicase, putative
Phymu_g863hypothetical protein PHYSODRAFT_309064
Phymu_g864HSF-type DNA-binding protein, putative
Phymu_g865hypothetical protein
Phymu_g866conserved hypothetical protein
Phymu_g867Intraflagellar Transport Protein 140
Phymu_g868hypothetical protein PHYSODRAFT_321832
Phymu_g869hypothetical protein PHYSODRAFT_476353
Phymu_g870hypothetical protein PHYSODRAFT_293759
Phymu_g871conserved hypothetical protein
Phymu_g872prolyl-tRNA synthetase, putative
Phymu_g873integrator complex subunit, putative
Phymu_g874hypothetical protein PHYSODRAFT_470654
Phymu_g875hypothetical protein PHYSODRAFT_533223

Sequence
37166 bases(100 bases per row)
GGCGaccgaagagctcaaggaTGTGGCTCTGAAGGATAACTACACGTTTGTGGATACAATTGAAGGCGATGACCAACAGACCAACACGCAGACGGTGCAA
GAGTACGTCGTGTGCGACCTGCAAGACGTCATTCCCGTGGTGGAAGGCGTGTTAGAGCAACACATGAAATTGCCGGCGTACAAGGTCATTGTCTTCTTGC
CGACTGCACGGTCCGCGCAGTTCATGGCGCAGCTTTTCCAGGCTGCAGGTTTCCCCAATGTGTTGGAAATGCATTCGCGTAAGAGCCAATCGGCACGTAC
CAAGGCTGCTGATGCTTTCcgcaagggcaagaaggtgatCATGTTCTCGTCTGACGTATCAGCACGTGGTGTGGACTACCCAGACGTGTCGCTAGTCCTT
CAAGTGGGCCTTACGGACCGTGATCAGTACATCCACCGGCTAGGACGAACTGCTCGCGCGGGTATGGAAGGCCGTGGCGTCCTGGTGCTAGCTGACTTTG
AAAAGGCAATGCTTCGAGATCTAGCTGACCTGCCGCTCACTGAACTGGAGCAACGTCCTCAACTGGATCAGCAAAACTACCGAACCACGCGAGCCCTCGC
CAATGTTCGTCCTCACAGTGAACTGGAACAGTCTGCGGAGAAGGCTTATTCAGCCTTTTTGGGCTTCTACAACTCGAACCTCAAGAAACTGAAAAtgtcc
aagacgaagctcGTTGAGACGGGTGCACTCTATAGCCAGCTCATTGGCCTGGAAAAGGTGccgttgctgcagaagaagacgttgcgAGCGATGGGGTTAA
TGGACACTCCTGGCCTAACCGCCGCTTCCAAGCCAGTCAACGCACGCAAACCCAAGTCGAGAGGTCCGGGAGAACTGGAGAGATTCACCAAAGAAAATAC
GGGAAAGTATGCGTCAATTCACGGGCGTAAGAAACGTGAGGGCGATGGAAAGAAGGGAAGTAGCTCATGGAGAACATTCAGTGGCAACGAAACCGGTCGC
TCCCGTAGTGAACACTCGCACAAGAGTGGCCGTAGCACTCGTAGCGCTTCACCGAGTAGCACGCATGAAGGACGACCGCACAGACACTCGCgttctgcgt
ctccagcaaccAAGCGGAATTACAAGGAGCCGCACAAGAGATACTAAAGGATGGCAATCTCATGTGATAGATAAGTGGTGTACGATTGGAGAAGACtaag
taccggtacttgTAGTCTTCTGCAAGACCGCTGTAGACACTACATGCATTTGTTGTTAGAAAGCGAACAGATCATAGTTCTTCTGCTAATACTACCTAAC
ACTTACTTCGAAGAAAAAGGGAATTCCTCGCCTAAGTAATGGACTGGTACCTGGACCGCATTTGACGCTGTGCAGCAAACCATGTAGCGGAAGCTCCAAT
AACAGCACCAATGACAGCCCCGATGCCAATCTGAACGACTGAAAAAAACGATGTGTTCCCGCCACCGACAGAATCCTGCACTCCAAGGTTGGCACCGACA
TTTTGCTTACTTTGAaacagctgaagctgcttttcCAACTCTGGAACGCGCGGTGGCACCAAAGTCTTACCTGGCCACTTGGAAAACTCGCTGAGCTTGA
GCCACCACTCCGGATAACCTGGCATTTCCATTTCCTCTGGGGCTTCACCAGTGGTGATGTAGCCGTCTGAGAACTTCCCCACTAGCTTCCATGCGAAAGA
CCACCACTCGTCTATTACTCGAGAAGCCAATCGGTTCGATTCTTCTTGCAGATACATACGTACTTCGGCCGCTGACAGGGATTTCGTGTGAGTGACATGA
TGTTCCATGGCCTTACGCTCGGCAAAGCAAGTCTTCTGCAACGCAACCATCCGAGCTCGGATATCCTTGCTGATAGCGTCAAACCGAAGCATGCTCCAGT
TGTTCACGAAGCTGAATGCCCACCAGGCTGATCCGTGTGTAAACTCACTCTCCTTTCCGAGGATGTAAGCTGAAGGCACCTCCTGCTGCGCACAAGAGAA
TGGAACGTACACGGACGCATGCGGTGAACTTTGACCGTACCAAGCCACTCCACCGACCGCATCGGGAAGATGAGCACGTGCCTGCAGCACAAAACTGAAG
ACCGTGCGATACATGGAAATTGGTCGTTCCCACCCGCCTACCACTCCTTTTTCATCACCTCCCCACCGCATCGGATTTCCGAACGGCCCTGCTGCTAGGC
CCTTGGACAAGTCGTACGGCGTACCTTGGAAATAGTCACGCAGCAAGTGTGTCACGTCCGCTACGTCGAGGTTTTGGTCCGGCTCAACTGAGAACGGGTA
GGTCGGAAACTCCGGGTAGTGCCCAAGACGGGAGTCCAACTGCAAGGACGGCGCCACAAGATCAAATACGCGCCATATACGACGACCCATGTATAACGCA
CGCACGGGGTCTGGAGTTGGTGAAGCGTATGCCGCCGTGAAGTCGAACTTGCCCTTCTTGGGTTCCCACCACCCCATTTCTTCAGCGAAGGACAGCACGT
TCTCCGACGCCATGAACTGGTCAGGATCATCGAGATCCATTTCACGTATCACGAAGCCGTTGGCCACCACAACTACGTGCGTATCAAGCACTCGTTGAGC
GGCCCAAACTGCACTAGCATTGTGCGGACCCGTCAGCACGTGGAAGACCCACACTTCTCCATAGCGGTCGGCAATACCCAGCGTCTCCGCTGCACTCACG
TACTCAGGCTTGGCCGGATCGCCGCTGTCTTCGCTGTAGAACCCGTATTTGACGGCAAGGTCACCCATCGTCTGGATTGCACAACAGGCCGAGTCGCAGC
GTTCCAGAGCCACTTTAGTGAGCTCTCCGATGCCGAAGATGTTGTATCCATGAGGACCAGCATCAATGGGCCAACCCACCGTCCTGGCACCACTTGTGCT
CTCTCCAATACTGAGCTGCACTTCGTTCATGAAGCCGTAGTCCTGGTCAAAGTAGCCGTAGGTATGCGGCACCTGCGGAATCTCACCCAGTGGGTTCAtg
accagctcttcgttctTGGGCTGGTACTCGGGTCCTCGCTGGGTGCTCACGAGGCGCGGATAGCCCGGTTGCACGTTGTATACATGGCGCATAGCTCCTT
GCTCGTGATCTCGAGCTGGCACACGCACCATCCGCAGGTCGGCAGCACCAAAGCCGGCGTCGTCAGTGTGCGCCACCAAAGTGGAACCGTCGACCGTCGC
GTTGCGCCCCACCGCTATCATCGTGCACGCATTTGCCAGCGGCAACAGTGCGAGCAATAGCAACTGCATGAGGTTTGTTAAATGTGCTGTGCAGCAAGAG
AAACTTGAAGTGATGCCGTTTGCCAAACGGTCGGATGCGATTTGTGGAACAACGTACCATTTAGAAAGGGTTCCAAATTCTTTACTTTTGAAGAGTGAAA
GTATGTTTCTTTCGCATAAATAATTATTTGGGTTAACTACCATAAAATACGGGACGAACGTTTAGGCCATGAGGCGGGGTCGAATGGGGCCGATGGCCGT
GTACGGCAGGGCACTggacagcgacagctcccGGATGGACGGCAGCTTGTAGCCGCTGTTCATCTTTCGGGCGGGGGACAGCACAGGTAGGCTAAAGGTC
GGCACCGGGTGCATCGGCGGGGACATGCTCTGGGTCTGATAAGACATGACTGGAGCAGCTACGATGACCTCCGCGGTGACAGCAGTGGGGCGTGGCAGAA
TGGGTTTGCACTTCTCAGCGAAGGTGGCCGACGCCATAGCTGCGCGCTTAACtgactgctgctcgtcatcgGCATTCGCTTTGCGCTTCCGCGACTTCTT
GCTCTGGCGCTTGACAAGTGACATCTCGCTGAAATTATCGCGGGTGAAGTGCTCCCGGCTGTAGGTGGGGAACTGGGCACGGGCCTTGCTCCACTTGCGG
AAGCCAAAGTAGTTgagttggcgctggaagctcgagAAGTTCTTGTTCTTAAAGTACTTGGGCAGGATCTGCGCAGCCATCGCGTCCTTGTCCAAGATCT
GGAAGGCCATACCATCCTCGGCCCAGCGAATAATCTTGGGGTCCTCGCGACGGAGCATCtggtgcagatgcagcaagAACGGGGCCACCCAGCCGCGCTT
CGGAGCCATCTCACTTGAGCTCGAAGAGGCTGAGCTGGAGGTCGAGGATACCGACACTGTGGGTGACGGCGGGCACTCGGGTTCCACCTCGCTAGAGAGA
AGGTCTTGCACGTTCATTTGTAGTAGTGACAACAGATAGCACTTGCGCTCGACAGGGCGGAATCGGAAATGAGACTGGCAGCGGAGCGCGTTTCTGATGG
CAAGACGTGCGGCATACTGAATCCCTAATAGTTTTCTTTTTTTGAATCTAGATTCGATTAACGATTTGATGGCTTGGTTTACTatctccagcacctctgT
CGAATCTTGCAGCGGTTAGGTCTTCATGCGTGACAGTGTTATGGCCCGTCTTTGCAAATATGGCATTTGAATCTCGCAAAATGTGGCAAATGGCATCGGC
AAGCTGTAGCTCTATCCCTGTAGCTTTTCGAGGCCGTACGGGAGTGTTGAAGGTGATACAGTAAATTGCATGTATTCGTACACCGTGATGAGGCAGAATT
CATTTATGCATCCctgtacatgcatgtaccTCGCATGAACGGTATGAATCATTCAGTGTGGACCGGCTACACCCGGGGTTCCTTTTGCTATTGACGGGGC
GAGTTCCCGATTTGTCGTTGGGATGGTGGAGATTCGCCGATTGACAGATTCGCTGGCGCCGCTGCAAACTtgcgtgttgctgctgaacacGAATCTCGGG
TTGGCTACGGAATCTCCAGTAGATTTTGTCTGGAAACCACCGCGAACCTGCTCATGCCTTACTTATCCTGTATTCTTGGGCATTAGCTTTTCACATTTGG
ATGCCGCCCGTGTTGCCAGACCTCCAAGCACCAACGCTTCTGTGTTGTTATTttcgtcgctcttgctgcacCTGCGTGCTCTCGAGGTCAATACACGTAC
AGTACTTGTATAATATTAAAATTGGTATTTGGGATAGTTTGTCGAAGATCCAAAATTTGGGAAATGATGAAGCCACATTTATTAGGATTCTTGCGATCTT
GAAACGACGCAGTCAGCATCTTACCCGCATGGTGAAGATTCGGGTGCGCTTCCTTCTCGGTACCGAAGCTCTTTGTGCCTCTAAGCTCTTGCTGCATCTA
ACATATTCACCCTCAGGGAATGTTAGTAGCTTCGTatcgctcgtgctgctgctggcggcgaGCAGTGGGCAGAAATGGGCTCATGACACTGTCAACTCTG
TGGACATCGGACTCTGGTTCCTCACGGTGTGAAGCCAGCGCCTATGACTTTGAATCTCTTGATCCCGTTTGTTGACTCTCCACCTCTGTTCAGGGTACTG
GCGTGCGCTACAAACTCATTAATGCTGGCGCCGCTGTTGACAGCACCGACGTCACGTCCGCGGCTCAGCCTTTCACGGCCtacaggagcttctggtaATG
CCTAAAGCTACTAGTTACAGTACTAACTGCGCAAACTGACGCTCCAGCAAGCTCTCTCTCAAGTGTTGCCTCCAGCGACCCGTGGTGTCTAGGGGATGCA
ACAGCCACAAGGGGATTCACAGTCTTGGCGCTTATCGCCGCCATCATGAGCTTTATAGTGAGCATCATGGTGACTTTTGACATCAAAATTCCCACTTGGA
ATGGCGAAGGCAAGGAGATCACATTGGTCACTTCCATAGTGTGTTCTCTAGTCGAGACGATGGTGCTTATCCCTGCTGTCGCGCTATGGCAGCGCATGGT
CGCCGCCTACGACCAGCAGTGCCGCGAAGAAATGGGCATCAACACGTTCACATGCATCGAAACGGGCTCAACACACACTTGCGGCATAGTTGCGATccct
tttgctgctgcaacttaTTTGCTCTGGCGGCTTTCGCATTCTTACTACGTACGCATCTTTAGTTTTAAATGCGCTGACCGTACCTAACTTCCATGTTTGG
CAACGATCTGCTAGGAAGCAAAACGAGCAGGCAGAATTGCTGATGGCTTTACGCTAGCTGCGAAAACAGGCAAGAGAATGCTTACATACATTCGCCACAT
TACTATATCTAATGAGCAGTGCGTGCTTGTGCAGACAATGTTGACGAGATACTTTCGGGCATTGCCAATAAGATCGACATCGATGCAAACGGCTCTGACG
GCAGAAATGCACTGCATTGGGCTTGCACGTTGCACCGAACGAGCATTTGCCACGTTCTGCTAAAGAAGGGAGCGTCGATCAGTAAGAAAGATGTGCGTTT
GCTGTAAGAAGCTACGAGTGCTGGCTGGTTCTGTATTAACGTAGCTCGCTCGCTGTATATCGCAGAGGGATGGCTGGACGCCATTGCACTGGGCTAGCCG
AGTTGGCAATCTGGATATTGTGCGCCTTCTAGCCAAGTACGGCGCCAATGTAAACGTACAAGACCGCTGGGGTACGACTCCGTTGATGCTGACGGTCGTT
GGAGAAAGCAAGCTCGCAGCAGAGACGTTGATCGAACTTGGTGCTTCAGTCGATGCACGAAATGTAAATTTTCATGTTAACATTACCAGGAAATGTATTG
GCAGAATGTTACTGAACATGTGCAAGCAGGTTTTTGGGCAGACGCCGTTGATGCAGTGCGCTGAAGGAGGAACACCTCTTCACCAGCTAGGCATGGTGTT
TCTTAATGCTGGATCCGACCTCACCTTGCAAGACGTACGTTCAAAAGGTGCTATCATCGACATAATTGCTAAAAGTGATGTGCATTTATTCGTTTGCAGG
CACAAGGTATGACCGCATTACACTACCCGGCTGCCTGCGGTAACTTCAATCTCCTGATGAACATGCTCCAGCAGTGTGATGCTGAATTGGTTGAAAAAAC
AAACAAGGTGAGCTGTAACAAACCTCGTGAGGTACGAATTATTGTCTAGCTAACACGGATGTATGGACACAGTTCGGGGAGACGCTGGCCTACCTTGCTG
TTCTTCACTCACACCCAAAAATATTGGACTTGATCGAGAATTGGCGAGAAGGGAACCCCATTGTTGCAGTACACGACGATAGCAGCGACGATGGGGGTGA
CGACAGTACAGACACGTCCGAGGAtagcgacagcagcagcagcagtgaagaaTACACTTGAAAACATCGCAACAACAGAGCAATGCAAAGATATAAACAA
AAAAGCCTGTGGATCTATAAAGTTTGAACTATCTCCGCTCTATTGGAGCTTCTCAAGAAGTAATTTAGTGCCCTTCTGCGAgtcgacgagcttcttcagg
tctCCCATGACGGGCTTGAGCGCTTTCTTCACCACCTTGGTAGCGTTCTTCGGGGCCTTTTCAGCCTCCAGGAACGCGAGGACCACAAAGGAGCCACGGT
TGCTGGTCGCCCACTGCGGCAACTGCTCCTCGACGGCGGAGAGCAGAGGCTCCGCGAACGAGGTTTCCTTAATCAGGCGGCGCAAAGCGTAGTGTCCATT
GGCATCACTGTGGAGaggctcttcctcctcggtCGGCTCCGCAACTACAGCGGTAGCAATGCTATCTGCCAGCTCCGAGCTCTCACTCCGCTTAGCGACC
TCCACAATCACATCACGACCCTCCTTCGAGCGCATCAGGGCAGCAGCATTCTCAGCACAcatctcttccagcttgGGCAGCAGACCCTTAAGCAGCTCCT
CGCGACGAGCATCCGGATCCTTCTTGTAGTTCACAATCAGGACAGTGGCGTCCTCAGGAGACGGCACCATGGGCGGCTCTAGCAGCTCCAGATCATCCGC
CGAGAGGTACTTCTTGTTCAGAGGGCtaagcagttgcagcagaacCTTACGTCCGCTCGGGTGCATGGCGATCGAGAAAAGCTCATCGTTCATCTCCGCC
AAAATGGACTTCTGCACAAGAACAGAGTCATCCACCACGTCGAAAATGCGCATGATCACGAGGTAGCCGCTGGGGTGGTTGCacgcgtccagcaccttgt
ccttgagAGCCTTAATAATACGCTTACGGTCCTTGGCAGCACCGAGAGAAATGCACTTGTTCACGACACGCGCACCGTTGCGGGTAGCGAGTAGAGCCAG
CGAAGCGTCACGTACGTTGGCCACCATAGCCACGACATCGTCGTGCTCGGCATTGCACATGTACTCCCACAGCAGAGACTGCACAAAGGCCAGACcgagg
agctgcttgtccaccaTGCGGTTCAAGATGGTGGTCAGGTGCTTGAGCACGtccgccttcttgtccgGGTGCGCGGCGATGATGTCCTTCAGGTTACGCT
TGCTCTCAGACTGGAAGTAGGCGAACTCCCGACCGTAAAACTCCAGCTTGAGCGCTGTGAGCTGCGACGGCTTCAGGTATTCCTGTGCGTACTCGAGAAC
GTTAGCAGCGATGTTGTGCGTGCCGATCTGCACGACGTGGCCGGTCATGCACTTGACAATGGCGGCACGGTCGGACACGCTGCCGTAACggatcatcttc
tgcaccaAGAAGCAACCGTActgcatcttggccagctcaATGAGgtgctccttcatctccaacaCGATCTGAGAGCGGTGCTCGGGCTTGCCGTGCTGCA
TGAGCGACTGGATGACGCGCGAGGCGTCGTGCTTGGCCGCCACGTCGTAGATCTTGCCCTTCACCAGCGTgtacagctcgtccacgagcGTGGCGCGCTT
GGTCTTGTCCACGTCGCGCTCACGGATGACGTTCCAGATCTGCTTGGCGCGCGTGACCATTTCGTAGTGCGGGCGCTGCATCTTGCGCTGtttcttggcc
agcttctggTCCATGAAGGacttcttgccgtcgtcaTTGCCGCTGGCGgggcgcttcttggcgttgaagccgcccttgttcttggcgtcgaagcCGCCCT
TGCTGTAgctcttctccgtcttcgcctGCACCGCCATGTCTGTCACTGCAACCTGTTGATACTGTGGAGCTCTATGAGCAGTGGCAACCAGTCAATTGCA
GTTCAATTGGTTACACAATTTGAACAGACCAAATGAAATTGGGAGGACTAAAAACGTTAGATAGTCCTGTTTGAAGTGTGACACACAAATGATCTTGAAA
CGACGCGTCGCTTCAAGAGCAATAGCATTGCGCGAAGATCTGAGGACTGTGAAGCATGGCCTTGTTCTACGACTATAATGTGGCGGTGCCGGCCAATCTG
CGGCAGATCTGCTCGGTCTGGGGGGAGCTGGACCCTGTGCTTGCTGTCGCATTGGAGAATCGAGAGATTCACTTCTTCACAGATGAGGTTCGACACAAGA
CCAGTGCTAACATATTACAGGTGAATTGCTGACATTTCAATACTACATACTCCAGGGAGAGAAGCAACAAGGGCTGGATATCTACTCGCGCAATGCTGAC
ATCGTCACGATGGCATGGCAACCTCGTGGAGGAGCACTCGCCGTTGGTTGGAGCGACGGTACGATCTTAGGTACACCATTAGATAGAGTGAGCTACTAAC
CGAACTGTTCTAGGTATGGTCTCGCTGTGGGTATTCAAGGAACAGACTGCTCGCGAGGTGAACTCTCCGCACTCGAGTCGTGTTTGTCTATTGACGTGGG
CACCCGCGGGCAACCGCCTCATGTCTGCAGATGAGAATGGGATATTTGCTGTGTGGAAGGTGGATAGCCGTTGTCAACTCACAATTAGCACACAGTACAC
GCGTCAGGGTAGCTTTACCCACTGTGTCTTTGCCACTCGATCAGCGCTGTTGAAAGACAGCCACTCCAAAAAGTAAGCTTTTCTTTCAGCATTGGTAATA
AGATGCCTAACTTGTCACTGCACAGTGATAATTTCTCCCAGCACGCTTGCCCACAGTTCTTTTTCGGCGGCGAAGCAGGTTCAGTTCACTATGCAGATGA
TCTGGGGCACATCTCGGACATTCAAGTTCTGAATCACGCAATTGACTCGATGATGTTTTACGAAGAGCAGAACCGCCTCATTGTCATCACGCGCGCAGTT
CAGCTTATCGTGTATCAAGTGGGAGCGACTGACGGCACCGTGAAGCCAATTACTAAGGTCAAATTGAGTttggctggagaaggttctCTTCTTGAAACCA
AGTGGGCAGGCCCCGGGCTACTAGCAATCGCATCTGGCGAGCCGTTAGTGCGATTCTGGAACATCCGCACGGAGGAGAACAGTGTGCTGAGCCTCCCCAA
GTCAAGCGGACTCAACTACAACGTCAACAACTTGAGTTTCTCCCCTCGACGTCGCATTCTCGTAGCTGGTACAGCTCAGGGAGCCGTGTTCTTCTGGCGT
GCCACCTCTTTTGTCGATGCATCTGCACAAGGCAACACCAACGCCGTTAATGTGTCGTATCGTTGGGATTTACTCTTCACGGCTGAAGTGGGGCGTGCAG
TTACTCGCATCGGCTGGAGCAATGCACACCCTTCTTTGTATGCCAATACTGTGGAAGGTTTGGTTATTTTGCACGAAGGCAACATGCAACGAGCACTTTG
TGGAGATACAGCCGTCATTCAAGTTCGCCCCAAGACGCTTTCCATCGAGAAGTTCCAAGACGGAGTGCAGTCTGGCGTGTCTATCACTCAATCGACGTTG
GAAGCTTCACTGCGTGTCAAGGGCATTTCGCACGACGGATCGACCGTTGTGGTTTGGAATGGCTCGAAAGCAGAGGTGTACGAGATGAAAGACGGAGATA
ACAAGCTCATTAACCAGTTCAAGTGCTTTTCAAGCTCTATGGTACTCAGGGGCGAATCGATCTACCGCGCGAACGGGAACCACGTTGAAGTCTGCAATTT
AGCTGGTGTAGTAAAGAACACCATCTCATTCACGGAAGCAGAGGGAAGACCGGCGATGTTGTCGCTGCAAAGCAAGTTCCTTGCAGTAGGTACAGATCGT
GGGCTTCTACGTGTGTTCGACGTATCTCGTCGTGACCCGAAAGCCTTGGGGAGCATGGGCAATTTATCTGAAGCTTTTGGTGACGAGACCAAGTCTGCAG
TCATGCGATCGATATGCGTCAACTCAGACGGCACTCGTATCTGTATCCTCGCTGACCGTGTCGAAGGTGGATTGCGAATGCGAGAGCCCATGGACAAGCT
CTTTATGTTCCAGACCGATCTCAACATTTACCAGCAGTTCGACTTTGGGTCTTCGCGCTACCCGGTATCCGCATTTTTTGACCCCCAAGAACCTCGATTA
CTCGTCTGCGAGACTGTAAAAACGGGTAACGATGGTGTACTCACCACTGGTGGTGCTAGTCGGCGAGATTTAAATGCCGATGATGGTCTAGGAGGCGGTG
CGGGTGGCAACCGAGGTAGCCAAGTCTCGGATAAGGAAATTACGATCATCTTTGCGTCCAATGAGCACGGGCTTCTCATGCAGGATAGCTTCGATCTAGA
CCTCAAGTATACTGCGCTGCTCGGTATCCAAGTCCCGCGCGTGTACTTCGTGGCTAAGGTGGATACTGGTTATTCGGATGACTCCACTACTGTAGTACAA
GTTGGACGCACGAAAGTCAATAACCCCGTTGCGAAAACCCCTACAGCTTACGATACAGTGAGTTACCTTCGAACGCAGATCATGCGCGACTTCACGGGCT
TGGACAAGGTCAACAGTGAGGCGAGGCAGGCTCTGATTGACTTCTGCTACTTTATGACGGTCGGCAACATGGACGAAGCTTATCGGTCCGTCAAACTGAT
CGAAAACCCTTCGGTATGGGAGAATATGGCTCGCATGTGCGTCAAGACAAAGCGGTTGGATGTGGCTGAAGTGTGTCTTGGCAACATGGGCCACGCCCgt
ggagccgctgcagtgcaggaggccaagaaggagccgGAAGTGGAAGTGGCAATCGCTATGGTGGCTATTCAGCTAGGTCTTCGCGACGATGCAGCTCGGC
TTTATCGAGAATGCGGGCGCTACGACCTCCTCAACAAACTCTATCAAGCCAGTGGGTACTGGAAGAAAGCGGTCGATATAGCAGCCAAACGAGATCGAAT
CCACTTGAAAACAACGTATCACGCATTGGCACGACACTATGAGGAAATGGGCGACCTCAAGGAGGCAATGGAAGCTTACGAAGACGCTGGGACGCATCAG
AAAGACATCCCTCGCATGCTTTTTAAACTGGGCAAGGTCGATCTACTGCAGAAGTACGTGTCCACCTCCAACGACCGCGATTTGCTAATTTGGTGGGCAC
AGTTTCAAGAGAGTCAGGGTCAATTTGATAGCGCTGTGGAAAGTTACCAACGAGCCAAGGACTACTTGTCCATCGTCCGTGTCTTGTGCTTCAAAAAGGA
cttccaagctgcagccaaaGTGGCCCAAACGAGTGGAAATCGAGCGGCAGCTTACCATTTGGCCCGTCAATTCGAAGGCCACGGTGAGGTCTCCAACGCC
ATCCACTTCTTCGCTAGTGGAGGATGCTACAACCATGCCATTCGTCTAGCTAAGGAGCACCGCATGGACGCCGATCTCATGGGGTTTGCCCTTATGAGCA
AGCCAACGGACATGCTGGACTGCGCTGCGTACTTCGAGGAGCAGCGagacatggagaaggctgtCCAGCTGTACCACAAAGGAGGAAACGTTGCCAAAGC
ACTGGACTTGTGCTTCCAGGCTCAGCTCTTCGAGGAATTGCATCACCTCACGGACGAACTCAGCGGCTCTGGTAACACGTCACCTGCTATTTTGAAGAAA
TGTGCGGACTTTTTCATCGCCAATGGCCAGTACGCCAAAGCGGTTCACTTGTGCTTGATTGGCAAtcgagcagtggaagctcttgatGTGTGCATGCAAC
ACGACGTGAAAGTAACCGAAGAgatggcggagaagatgacTCCACCGAAAGGCGACGACACCGCCTCACCCGCAGACAAGAAGAGACGCACAGAGCTTCT
CCTAAAGCTTGCCAAGTGCTGCAAGCAGCAAGGTGCGTACCACTTGGCTACGAAGAAATATACGCAAGCTGGCAACAAACTGAAGGCTATGAAGTGCCTA
CTGAAATCTGGAGACacggagaaggtggtgtTCTTCGCCAATGTGTCTCGGAACGCTCAAATCTTTATCCTTGCGGCCAATTACCTGCAGAATCTGGACT
GGCGCAAGGATCCCGAGATCCTCAAGAATATTGTTGGCTTCTACACAAAGGCGCGGGCTTtcgagcagcttgcagcCTTCTACGCTGGTTGTGCTCAAGT
TGAGATTGAAGAGTACCGAGACTACGATAAGGCCATTTCCGCCTTGCAAGAAGCGGTGCAGGTCGTGTCCAAGTCTCGTTCGGATGGAAAGGAGGCGCTA
CTTAAGCGCTACGAGAAGCGCATCTTACTCATTGAGCAGTTTGTGATCGCACGCCAACAGGCGAAGCAGAACCCGAAGGGGATGATGGAAATCGTCACTA
AGTTACTGGAGGAACCAGGAATCGAGGAAGCTATTCGTGTGGGTGACGGATACGCCATGCTGGTGGAAGGTTATTATGAGGAGGGCGAGCTGAACAagag
cttggagatgatggaggagatgaaacGCAAGGGACTGACACTCAAGTCGTACGTGGATCCTCGAGTCGTGGAAGCTGTTCAGGCGAAGCTTGGGGTTTCT
CTAGGGGACGACAGACGTCGCAGACCCTCGCCCAGCGACTACAAGCagtcgtcctcctccagtcgtCCAGGATCACGTGAAGCCAAGTCCAGTCGACCAG
GATCGAGAGAGGCGAGTCGCCCAGGGTCCCGTGAAGCACATAGCAGTCGTCCAGGCTCTCGTGAAGCAGCAATGAGCCGTCCTATATCACGGGAGGACAA
AATGCGTCCTGGGGACGATGAGATCGAAGATGAAATGGAAGAAGACATCGCTGAGGACGAGTAAGTGACGTCGTAACTGCAGGACTACGTACGTTTGAGT
TAGCATAGCCAATTATGGACATATTTTCACTAAGTGTTCACCTTGCCTCCATTACATCTGAAACGAAACGAAATTCCCAAGATGTTGTTCGTATCTGAAA
CCTCGAGGCCATGCACAAAGCAATCGCAGGACCGACAGCCGTAGATGATGCTGAAGCTACAGCGCTGCATCCCGACGATCCGGATTCAAAGCCGGAGACT
GATTCCTCGACCGTTCAATATGATTCACTCAGCTGCATGACGCCATATCTTACCTGCCAGCGATGCAATAGCGTCACGTTCATCGATGTGCAACGAGTGC
GACGCAAAGCAGACCAGCTAGTTGCCTCCATACAGCCTCTTAACGAACGGGAAGACACTACTTTTCTGTATGAACAAGTGCCCAAGTGTCCAGGCTGTGG
GAGTACGCGATATCTGCGTGCAGGAGTCGTGAGTTTCCAGGAACagatcgaggaggagcgaAATGCCATCAAGGAGTTCGAACGTCGACGAGTCCCAGCT
ACTGCTTTGCTCCAGCGTATCGCGCGTGGGTTCCTTGGGCGAATAGAGTTCCGCCGACGGCTAGTAGAGCATGAGCGCCATCTCCGAAAGATCCATCGAG
CGGCTACCAGAATCCAAACACGAGTGAGAGGCATGCAGGCACGGAGACGGACTCTCATCGAGCGGTGCCTGAGAGTAATCCGCTTTATGGCTCCACAGAT
CCTCAGCTATGCGTTAGCTGCTCGTCCGAATGAGCCACCGGTATTCTGGTACGCAAACGGCGCGGAGCTTGGAGTGTTTTATTGGAACTACAGGGAGTAC
GTACGACGGTCGGGAGGTAGACCGACACTGATCAAAGTGGAGACTAACGTGTTGGAGATCACGAGGCGCGTCCTCCGTCGTGAATACGAGCTCGTCAGTC
GGATTCAAGCGCGATGGAGAGGAATCACCACACGGATGGTCTTCCGCGAGTTTAAACGTCAGAAAGGATGGCTCAAAGGCATTCGACAGTCTCCAGCCGT
GAAAATTCAGCGTCTTGTCCGTCGTGATgcaagtcgtcgtcgctgtcgagcATTGCAAATTACAATCAAGTACCCAACGCAACGCGAAGCCTATCGTAAG
GAAATGGCGATCCGCGAAcagcaggcgaaggccaTCGCGTTCCGTCAGCGTCTGATGGCCAAGTACAAACAACAATTCCAGATCAACCGCACAACGCGCA
TGATCGTGCAGGAGGTTAAAGCGTCCTCAGTAGCCAAGAAATACGGAGTTCCTTCggcggacgaggaggatgcAAGCGAGTTGGGACCGGAGACAACTTC
ACACGTTCAACACTCACTCAAAAGTGGCGGAAAAGGTCTTGAGAACTCAAACGCGGTCAAATCTCAAAGCAAATTGAGCCAACTACCTCGAAACCCCAAC
GCGCTTCGGTTCGCCGAGATAAAACGTCAGCTCGACGGCAAGCAAAGCAAAATACGCGGGCCAAAACTCCACATCCTCAAGGCGCAGATGTACACGACGC
CCGCTGGTTTCTCATCCATGGACGATCGAGTGTCACCATAAAGGGTTAACCCATTCAACTTCAAGGGTGCATTTCGGACTTAATCGGAATGTCGCTGTGC
CGCACACCAAGCACCAGGTGGTACAATTTGTACAAACCCTATGAATGCGTCATTCGGCAACTTGCATTCACGCCAGCAGATCAGCAGAGAATGAGCATCG
CGACAGGCGCCACGGAGTGCGCTGTGGTGGCCTTTGGCTGCAACGACGACGGGCAAGTGGGCACAGGCGCCAAGCGCAGACCGACTTTGGCCATTGACGA
CGTGTCGGCCTCCAATTTCCCCCAGCAGCTCGGTTGTCTGCAGGGCGAGGAAATTGCCGCCGTCTCGTGCGGTTCTCGCCACACAATGGCGCTCACAGTC
AACGGTGTTGTGTATTCTTGGGGCTGGGGATCGGTACGTGAAGCAGCCTATAGCCAATGCTTGCTTACCTACTGAATGGATATGCTTTTGTTTGGTTGGT
TGGTGCAGATGGGACAATTGGGCCATGGAGACCTCAAGAGCATCAACGAGCCCCAGAGAATTGCGTTCTTCGAGCAGGAAGGACTCGTGATTGACTACAT
CTCGTGTGGAGGCTGCCATTCTGCCGCGGTGGCCAATGACGGAACGCTGTACATGTGGGGCGAGACCCATTGGGGCCAACTTGGTCTGCccaaggagttc
gaggctGCGCACGAGTCACTGCCAGTCAAGTGTCCGATGCCTGAAGGTGAACCTGGCGAGGCAATCGTGAAGATCAGCTGCGGTGGCACTCATACCGCTG
CGTTGACGAACCACGGACGTGTCTACGTCTGGGGTCGAGGTGACAGCGGCCAGTTGGGTATCGGTTCGGCGTGGCTGAAGGACACGGATGATGAAGGTCT
TCTTGGAGTTAGCCGACCGCATCTAGTGGACGGATTTAACGGGGAGAAAGTTGTGCAGGTTGCATGTGGTGCGTTCCACTCGGCTGCTGTGACGGAACAT
GGACACGTTTACATTTGGGGAAAAGAAGACTACGGCATGCTCGGTGTTGGCCAAACATCCGACCAGCAGACTCCAAAGCGCGTTGAGTTCTTCGATGAGA
TCCCAGCGCTGTACGTTGCTTGCCTTACTTCTTTGCCGGGTACTGGAGCTTTGTTGCTAACAGATGTGTTTTGTTTGGGTTTGTGCAGACGTGTTTCGTG
CGGTGGTTGGCACACGGTAGTTGTCGCCAAGTCAGGAGCCTGCTACGCTTTTGGACGAGGTGAATACGGCCGACTGGGTCTTGGCGATACAAAAAGTCGT
ACACGGCCACACTTGGTACGGAGTAGTGAGTGCTTTCAGTGGTACTATACACCGTTAATTAACATCTCTGACATTTTGTaggtgaaggcgctgaagggAC
AAACGGTGATTCAAGCTGCGTGCGGCGGCTCTCACACCCTGTTCGTGACGAGCGACGGCATCGCTTACGTTTCAGGACGACCCGAGTGCGTAACAAGTGT
TTGAGCTTGCATTATCTTTGTTGACAGGGCTTTAACAGTGTGTATCCTTATGTTTTTTGCAGTCACGGAAGATTGGGATTGGCGGACATGAAGGCGTTGG
CCGTGCCCACGCGTCTCGAGCTCGGCTCAATCCCTGTTCGCCAGGTATCCGCAGGTGGCGCACACTCTGTGGCTGTAATGCACAGCTCCCGCCCCATCTT
CTCGCCAATGATCTCTCCGCTTCCTACCAACACACCAGTCCCGCACAGCGAGCTCTGATGGACATAAAGCTTAGAActggaaaaaaaatacaaacCCTCT
TTGACTTGCActacaagttgcagtttATCAAATTCGATAGAAAGTAGCCATATCATTTTCGTCAAACTTGAAGAGTGAAGGTCTCACTTCGCTTTTCAGA
ACAATGAGCGAAGACGCCGCGTcctcaagctccagccactCGCGGGACCCCAGCTCCAGCCCCGCATGGCTCTCCACACAGACTATCGAGCGGTCATCTC
GACACAGTATGCTCCGCACCACCGAGAAGTCCGTCGTGTTTCGTATGCGCACACAAGAGAAAGTATCCGGGAGTCGAGGGGGAAGACGATCCCAGCAGAT
GTTCAAGCGGGGAGATACACGCGGGACCGACGACAGAGACGTCAATGAGATGCTGACGGAGCtgtacgttgaagtggaggcgaagaagcagtggctgcaa
agcgaggaggagatgtttgaacgaggccaagaacgcTTACAGAGCTTGAAACGACAGCACGCGGAGCTTTTACGCACGATGGACCAGTGCAAGCGACGCA
GGAAGGAGAGAGTCAATATCCGGGAAATGCTACGAGGAAATGAGGACAACGGTGGAGCCTACGAACGGAGGAGCAGCATTGACAGCAGTAGTGACAGCGA
CTACAGCAGCTACCGTTATCAAAACAGGAGCGGTAGCAGGCGTCACCATCGGTCACGACACGACGGAGTTAAGAAGGAGCGCAAACGTCTACGCCGATTC
CAGAGCAAAGTATCCTTACAgttccaactgcttcagtcCGAGTGCCAACGCTCGAAGCTGGAAGTTGAGAAGGCGCTGGCAGAGGTCCGAAGCAAGTACG
CGGACTCGTATCTCTTCGGCAACTCGTTTTCTTTTTGAGTAGTTTAAACGGTTTAATGTCTAAAACACATCTAATACCCGTTTCAAATTCGTTTCGCGCC
AGCCAATCAAAACGCTTCCCTCCTAAAACCCGCTAACCTTCAATTCAATCGAGAAGAATTCGATGTGGGCGACCCAAGCCGGgctcgaggacgacgaccc
GCGTGagatccagcgccaacgcgaGGCTTATGCGAGGGAACTAGACCACCAGATCGCGCTGCGTCGTGcgcgccagcaccaggagcaGATGGAACgcgag
gaactggagcgcAAGCTGGCGCCGAGTGAACGTTCGCCGTCCAAGTGGCTAGTCGAAGGCGGCTATTTGGACCCGCCCGCGGCCTCTCAGTCGCCCTGGA
AGTTCTCACAGAGCGTGGATCTACAGgacgagcaacagcaagaccGAGGAGCTGCCACGGGCGAGGCGAACAGCGTGTCATCGTCCCATCCGCGCTTCCG
AGTGacggacgagagcgagacCAGTCAAAGACTTCGGGAGCGCGCACAACAGATGCAATGGAAACGGATTTTGGACGAACAGGTGCAGGAAAAGGCGCgg
ctgaaggagcagcaagaagcggagcGCCGACGCAGTGAGGAGGACGCAGCTAAAGAGGAAGTGAGGTACCTTCGAGAACAGCAGATGCGAGCACAAAGAC
GTCTCGGGCAGTTCTCACCTGCGGTCAATGCTGAGGCTTTGGATAACAGAGTGGAGATGAAGTTTCCGTATCACACACTGCCATCGCCGCCGGAATTGCC
GACGAATAGACAGAAGAACGATTTCCAACCGACAATCCGACAAAACTATGCATTCCACAATGATGCAAGGGAGGAAGAGGACAGGTATCATCAGAGGGAA
CGGCAGTTTGAAGATCACGCAACTGCAGAAGTTCTACTTCCTCCGCCTGCACCGACTCGGATTCCGTTACATCAGCACAATGGGCACAGTGATTCGAAAG
ATGACATTCGAAACACATACGATCGCAACACAATGAGCAGTGGTATTGCTGCAAGACAGCAGCATTCTCAGGACAACGATTCACAGGCATCACGCCTACA
GCTTGAGCAACAGAGCCGAATTATTGAGGAATACCACTCGCTGCTGGCAGAAATCCGCCGTGAACGTGAGGAACTCCGGAGAGAAAGGGATGAGGTGCGG
CGTGAGAAGGAGGAATTGCGCGTACAGAGAGCTTTAttgcagctggagaatgAAAAGATGGCCAGTCTCGTGGATGCTCAACGAGCTCTcaatgagcagc
agcaggcggacctacagacgcagcaggcacaacaagcgcagcagcaggcgctgcagcaagccCAACAACAGCAATACCAGTCTAtttcgcttcagcagcg
actATCACCCGTTCAGCCCCCGGACTTTGCTAATGTTCGCAATGGTTTCGAGCTTCCAGATCACCAATACGCTGCTTCTGAAGCTCAGGCTTATTCGCGA
CTGGACCAGATTCGTCAGACGCTTGGCGGCCTAAGTatccacgacgaccagccCCAACCTACAGTGCAGGGTCGACGGAGAAAGCCGCCAAGTCCGATGT
CCATGGCAGATTTTTCGGCGCCCACACCTCAGAAACGCTTGACTGTCAACGCTACGGAGTCTCCGCGTTTCCAACGGTTATCACGGTACAGGCCGattcc
agcagttccagacgACGAGAGCATATTAAATCAGTCTTTGACTGGTGAAAGCGTGTTCGTCCCGTTGAGTCCCAAATCACAGAATCAAGCCAACAATGGG
CCTGCACCACGAACGACTTCCTCTCCAACTTCTGCAACCAGGCAGGGGGACAACCGCCGTGTGAATCCCATGCGAAGTAGCCGCGTCATCAAGAGCCGAG
GCTTCTACGActtcgagcaggagctcaagagcgacgaTAGACTTGACTCGCTCGCTAGCGGATCCATTCGTGACAGCTTCGGCTCAGACCTCGGTAGCAG
CTTATACGGAGACGACGAGGTCGAGGCtagtgatgaagacgagctggacgagcaaGATAATCACAACGGGGACTCGCATCtagcagccagcagcagtctg
TTCCAGGTTCAAGTTCTCGTATGAGACTCCACCACAGAGCTTATAACAATATATGTATTATTTTCATGGGTAAACGAGCGtagcgaggaagagaacTCCT
TtttggttgaagttgcttttTGCGCGCGTCACATTTTTACGTGGTTTACACAAAATCGATGGTTGGCGCAATTTTCTCCTCAGTTGTCTGTCATTCGTTA
GAGTCCAAGATGACGTTCCAGTTCCCCGTGGCTagcggcaagaagaagaaagtgcAAGTGTTTGAGTGCCCCACtgagagctggaaggagcgCAAGCCTC
GTGCTACCAAGGTGCATGCTTTATTGTTGCATAATTGACCCGATATTCCATTGGTTCTACGTCTGACACACTCTCGTTTTGACCAGAATAAAGCCAAGGA
CGATGAGCCTGAGATGACGCTGCGTCAGGAGATCCGcaaggagttcgacgacACATTCGACTCGGTGTTGGACTTCGGTGCGTAGTTCTGTTGGCTTGGT
GCAAGTTGCTGCGGCTAGAGACACTGAATTCGTTTGGTTGTGACAGCTACGTCGAATTTAAAgggcaaggagaagaaagctcATGAGGCGAAGAAAATTG
AGGCACTTGGCGGTAAAGCTGCCAAGAATCGCAGTGTGCCTTACAAGATGCTTATCGGAATGAAGACCAAGGGTGCAGTCAGGAAGCAACGTCGCGAGGA
CTTGGTATGGCTGAGATGCAGTTTTGTTTTTATTCAGTGGTGTTTCTTGTCTGCAGTTTCTAACTGTTTGCACTGCaatcggtgctggtggtggtgaatT
TTTAGCTGAAGGAATCGGATGTGGTGACGGGCAAACGGAAGGCAAGCGGCAAATCGATagaccagcagaagcgcaagaaggtTGACTTCGGCTTGCAGGC
TACCAAGGGCAGGTTCAAGGGCGGCGTGCTGGATGTACGGGGTCTGTAAAAATATTGTTACGCGGAATTCATTACTGAACTCTTCAACACCGGTACCATG
TACCACTCTCCATTCGGATCTTTTCATCTTTTTGAGTGtcacgatggaggaggagaccaagacgcGCTTCAGTGAGGCCCTCTCGTTAGCATTGACGGAG
TTGCCCCTCGTCTTAACACGGTGACTGCATCAGCTTTTTCCTTTTTCGATGCAGCGCATACCGATGGCTACGTCCCGCCGAGAAACGACCCAAAGAGACT
CGCTGACAGTCAGTTGATTTCACACCAACAGGGAAAAGGATTCTTCtctgaggaagaagaaaacgagTAGGTATTCACTAGTGTAGCTCCTtgtgatttt
tttttttatctcCATTGCGTCTTGACGACGAGTGCTGATAACAGAGATATCGTGGCAAAGATCCACCGTTGGAAGCagtccaccaccaccaacgaGAGTA
AGACAAAAACTCCGCTAAAGCGTCAAGAACTGCACAGTCTTTTCGCTGATCCCATGAAAAGGAAAGAGGTACGTTGAACGCAAACCTATAAAGGAGGCAT
TGCTTTAGCTCTCACCATTTTTGATACAGAAGTCTCAGCCGCGGGCAGACGACAGTATCCCAGTTACACGTGACGATATTCAGCTGAGTCGCCTACTGTA
TGCATCCGATTCCTGCAAAATTGACGTTATGTTACAAACCTGACGCGAATTCTGCGGATACCGTAGGGATGACTGCATGCTTGGAGACAAAGGGGATCGT
ATCATGCAGCTGATGGAAGATCTGACCACGAATGACTCACCACCGTCTGAACAAAGTTTAAGTCCGCTGAAGAAAACAGAACAAGAGGAGCCACCTGTGG
ACTTTGACGCGTTGTTTTCAATGGAGGACTTCGAGAAATACATCGCTGAAAACTAAATACGCTAATATATTAATGTTGGGCACAAACCAAGTGATAGAAG
TACTACACCCACTCGTACAACGCAATCACCGATGAACGTGAACGATTCCGGTGCACAACCTGCTGCTTTCGGATCCATTGTCGGAACCCAAAAGTCCCAT
CTCCACCGATGGACTCGCGCACTTCACTCTCAAGGTCGAGATCATCGTCAATCACAACACACGACCCACGATCGCTTAGGGGCATCGCGTCCGTTTCGCG
GGGCTCAAGCACCAGAGATCGAGCATAACGGCTTTCTTCTGATGAATACGGCAGTGAGACGTGCAACAGTTTCTGCAATATCGAAGCACGCACAAGTCAG
AATTTGCACGGAATAGCAGTTGGTTGTATAGCTTACGTCAATGTCCTCGTCGTTCTGGAGAGTGTAAGCAACAGACTGCCGATGTAAGATTTCCATCGAC
AGCTCGCCCATTCGTCGCAGCCGGTTCGCATTCACCATCCCCTCTTTGTCGAATGCAGGCAGCTCGTTCAACCCGACGAAGCCCTAAAGCACATCTACGG
CGTCAGATAGATTTCACCCTAAGATTGTGACGAAAGTACAGACCTGGAGATACAAGCCGATATAAGGCATGCTTGGATTGGCAGTCTTGCGCATCAACCG
GTTCATTTCGCGACACCCTTTGTCCGAGAGTAGTTGCATCTCGTTCATCTTTTTCTTCGCACCGACGTTCAGCTACAATATAAAACCAATAAGGTCAGGA
AAGGCTGGGCATTCTACTAGCATGAGCTTCGTAAACGTACACAATCGATGGTCTTTCGAAGCCGCTGCACTGCAGTAGATTGCAGCGCATATAAAATAGC
AGCTAGAGTATCGTGGTTGTGCAATGACATACAATAGTCGGCAGCCTGGTCATTCATAATTAGTATTGCGCGTACACAAGCATTTCCAACATTTATGTAC
CTTGAGGTAAAACGAAATCACTTCTGCACGCTCTTCAGGGGTGTTTTGGACCAAAACCGCGTTGATCACATACGCAGAAATCTACAACATCAAAATTGTC
AGAACACACTTCGTATCAACTTTCCGGTGGCAACGTACGTGTTGGAACCATCGCTTGATGCTGATGAACTCAACTAAATGCTGATTTTTCGAGCTCGCCG
AAATAAAATCTTGGACTGTGGTTCACAACAAGGATCAGTTTCCTCCTTCACAACGATAACACTGTACAGAAATTAAACTCACCTGGGATTCTGCAAAAGA
CGGCGTGTGTCAAAAGCGTGCATTGCTCAGCCCACTGCTCTGCTTCGATATACCTGATAGTAAAGTGATAACACTCGTTTTTCAGTAACGCTTTAGTCAA
CACAAATGAGCTTACTACTTACCGATGCAAATGCATAGGGAAAGGCTCGTTGGAGACAGATTCAACGCCCGAGTCTGGACCGTAGATCTTGGTCATCGTT
TTAGGAATCACCTCGTAGTTCATCGCATAGTTTCCAGCTCCCCGAAGAGAAAAGTACTCTTTGTAAAGAGTGGCGTACTCATCAATCAATGGGACGAGCT
TTTCCTTCGGGACGTCAACGTTGTAGCTAATGAGACCGTAGAAGCGGTCGCGCAGGTCGTCGGCTTCCTTTGTTTCTGACTGCCTGAACAGCAGTATCAT
GATAAAGAGTCGAATAAGTCCGTGGCCTAGATAAACACAACGCAATGAAATTAGTGTTTTGTCTGCAATTCGACTCTGTAGAGCCTTTGATACTTACTTT
TGATGCCATTTCGGAGATGCTCACTTAGCTGATCCACCACTTCGTTCAGGCTTGAAAAGCTGTCCAAGAACAGGACAAAcgccaccacgtccaccaAATC
AACTTCCACACCGGAGACCAGATCACGAATCATGTCCTCAATTGTCCTCGAGTGCACAGATCGTGAGGCGCAGTCGTTCTTGTCAGTAATCTTCCACGAG
TTATGAGGCATTTGAGCACCCAGGTATCCCGCAACCTTGTTCACCTCGATGCGGTGAGTGTAGTCGACAGACGAACACCCAAAGATGTCCACATCAACAC
CGTTTCCTCCCCGATTCAGCGACCCCAACTTCCGCAGTAATCCGACCACACGAGAATCTCCTGAGATATTTGCCAAGTGTGAAGCTTGGCGACCAAATAG
ATCGCGTTTGTCTAGACGACAACCAGCACATGTCAAAATCTCCAGGCATAAAATTCGACCACCCCCATCGACGCCAGAGGCGGTTGCAAGTAAGACTGTG
GCTGGAGTTTGCCCATACCGGTTCTGAGCGTTTGGGTTGGCGCCACTTTGCAGTAGTCGGAGAATGATATCCGTGTGAGCCAAGGCGGCTGCAAAGTGCA
GGCTGGTGTTTCCGTCTAATGTTGGCGCATTCGGATTCGCTCCTTTTGAGAGACAGAGCTCCACAAGCTCAGTTCGCTCACTCTTGACTGCAAATTCCAG
AGCTGAATAGCCATTTGACCACGCCACACGGTTCACATCAGCCCCCAGAGCCAGTAACGTCGCCGAGCCTTCGAGAGACGATCTGGAGCACATGAACATC
AGCGGAGTAAGCCCATGTTTCTCCGCTGCATCGATATCAGCTCCTGCATCGATTAGACTTTGTATGATCATCGCCATATCGATCGACTGTTTCACAACGT
GCAGCGGTCGCCTTCCTTTGTAGTTGCACAAGTTGGCATCTGCTCCCTTCGAGACCAAATAGTTGACCATTCCGAGTTGTCCGTTGTGCACAGCTGCATG
AAGTGGAGAGCCTTTCCCAGACACGGGAACAAAGCCGAAAACCTGCATTCCACGAGATTTCTCCCACGAGCAAAGCGTGTTCAGCTCCATGGTCGAAGAT
CTTAACCAAGCGGCCGAGTCCAAGTCTCCACGGCGAGCTGCGATACACGTCAAGTAGCGGGGCATCTCCAAGTCCAGCGTCAGCAGTTGATAGTAATAGA
ACTCGGTCATGAAGGTAAGTTGTTTCGGCAATGCTGCAGTTCTGACGCGTTGAATAATCTTTTCGAAAGGCATCCCAATCACAGGTTCGTGGTTGATCGC
GATCAATGAAAGGCCGGGAACGATGGCGGTGCTCAGCGCTGCTTGCGACAGCTTACGGACACTGTACACAATAGCCCCTCGCCCGTTTCCATCCGTCGTG
AATTGAATACCAACGTCATTGGTCGAGATGGACACTGAAACACGGGACCCTGCGAGAGCCATGGAGTCAAACTGGCAACTTTCGTCGCCGGTCTCGAAGC
ACTCGACCCACTTGATCGCATCGAGAAATGCTGTCACGATGTTCGCCTTGTTCTGACACGCTGGGTGGTGCTGATAGCCATACTTCAGCAGCGCCCGAAC
GATGGACAAGTCacgcagcgacgacatcgtAACCACGTGCCGGAAAACCGCCGTCAGCGCCTCATCTGTAACCTCGAAGAGCTCTCCGTTAACCTTCGCA
ATTGCCTCCATGATGGCCTTTCCGGATGCTAAAATCACCTCAAACTTGTGCGTAGGTAGTGAGACACAGTCGAGCATATTAATCACACTAATCGCTTGCT
TCCAATTGCAAACTGACAGGTCTTTCGAGACGCCGAAATCTGCCTGtgccttctgcttcaatACCTTGATATTCTGCTCGACCTGGctgcgcttcgactt
catttTGTCCGTCTCAAGGCTCGCGTAAGCTTCCGTATACAGCGCAATGAACACACGGTCTTCCACGTGTCGACGGATGAGTCGCACCAGGTCATTACCG
GGCAACAATTCAATCTCCGGGTCCTGATAAAACTCCAAGTGGTGGCGATCAATGATGGCGTCATCCAATTCCACAATGAAGTTGTGAATCGCCGCGTACG
AATGGTCCTGCTCAAACTCCTTAAACTCCACCAAGCTCTTGGCGATCTGCTTGTCCGTGATGAAGATCTTGTTTAAGTGTCTGGTAACTGCATTGGAGCC
CGCTTTCTCTTCAGTAGCTGTCAGATCCACCTCGTAACAGGGCGGGGCTACTCTCCTCACCGACCTCAAAGCAGTGACCCAAAGCTCAGCTTCAAActgg
ctgcagcagtagcaCAGCAATTTGTAAAACCCTTTTTCAATCTGGAACACATAGGCTTTGTCCGCCACGCGGATATCCACATGTTGTACGGAAACCACTC
CATCATTGAGCTGCATACACCCTTTAATCTTCTTCCGGCCTTTGTTCTTGTAGTAGGCGAACGTGCCGTCGGAaaacagcacgaagaagcgcgtcttcca
gctcttccacatGTGGCCCTGCTTCGTGAGCCACCCCATCTTAACAAAGTTGCCTACTTGCACCTGAGTCGCGTAGAAATTATCGTTCAGAAGCGGATCG
GAGCCGTGACGCACCAGTCGAAAACCTTTTTCTCTCTGTACGAGAGTCTGCGGCGTCTCCGAGGCATCAGATGACGAGCGCAACGTTCGCAACAGTGGTC
GGTCTCCAAACATGGAGGCTAGAAGGCTGCGGCGCTTGTCCCGGTCTATCTCTTCCGTtgcttcttccacttccagctccacgtgccgcgcctgctgctg
cgcgaggcTCTTGGCGCGTGTACTGCGACGCGAGAAGTGCGAGCGCTTGCTGACTTTGGGAGCCGCCTCGTCCAGAAGCGCTGGTGGTGATGACGGATCC
CGGAAGGAGCTTTTGCTCTTATGGCGCCAGCGCGAAGCCATCGGGTTTTCTGTAGCTGGCCCTTTGATGCAGAAAAAAAATTGGCTGTTTGACCTAAGCG
ACTCGTCACCTAgcctaaaaaaaaaataattcCGCTAAAAGCAGCTGTTTTCCAGCGGTAGAAGTTCAATTTTGACGACAATGCACAGGTAAATGTGGGA
CGGAAACAAGCGCTCATGCAGAGAGTTGATGGAAATGAATGCACAGTGTATTATGGAACGTGCAGCATGGGTAGAAAATCCACCTACACTATTTTCCTGC
GTTGGACTGATGGCTGCATTCGCTTCGCTTCCAACATGCGTGCGAGTATTGTGGATCAACCAAGCACTGCCGGCAAGTGAGCCCCCGTGGGTTAACTCTA
CCCGTTGGCCAAAACCATTGTCGTTTCGATGCCGTGCTTGACGAGGAACTCGACGCTACGTTGCCTGTGCATTGCTAATGAACGTCGCTACGATGCAGGC
CGGAACACGAGTGGGCGACGTGCGCAGTGAAAACCCCGCAAAAGCGTCCTTGAGGCCGCGTAGAGGAAGCTCGCCATGCTCAACAAGTTGTGTGGCAATT
GCCGCCcagctggcgttggcgtccgCATGATCATCGATGAGTcagcgctgcttccactttgcggctgcagcagtacaACTTCCACCCTTGGAGTGGCAAT
ACCGGGCTCTCTGCCCTTGCCTTCTCCATGAGCAATGACTTATTTTACCTTGCTAGAGAGAAGCCGTTTCGCTGTGCTGCCGCCACCGACGGCGAAAAAG
CTTGATGTATCTATCATAAGCAGTGAATGTGGAAACCCAGTCAAGTCTATCTTCAACACAAGCACTATGAGCAAATCCCCACTTCCGACATGTCTTCACC
AGGCCTTCCACCTTTATCTAGTGTTCAAGTTGAGCAAACAAAGTATCGCATGCTCAATCAAAGCTACACTGTAGCAATGCCACCAAAGTGCAACGACAAT
TGCCAAAAGTGACTTTTGGTATGGTAATACTTGAAGTAGTTCTTCAAGCAGCATCAAAAACCTGCCATCGATAATGtcgtgtgcaccacatcTCCCGGAT
ACTTACATGTACGGCTCAAATTGCTTGTCAACCAGATGTGGGCGGTCTGCACGCGTCGCAGTTCCTTGGCAGCTGCAGGGCGGAGCCTCTCGACGTCGCA
GTCAATCCGCACTGCTCCCTGCGCCTTGCGGTCCGTGCTGTGGGCTCCCACAGAGAAGCAGGCGCCTTCAGACGCGGCAGTTCccagccaccagctcctg
gtgcgCGCTGGTTTCGTGCGCAAAGGTGGTCATGGTCTCTTCGCTCTGTTGCCGCTGGGCCGCCGCGTTATGGCCAAACTGGAGGCGATAATTGACGACG
AAATGTACAAAATTGGCGGTAATCGCGTGGACTTGTCGGTACTGACGCCCAACGAACTGTGGAAGCAGTCGGGGCGTTGGCAGAGTCGCGGGCCTGAGCT
TATGACGCTCGAGGACCGACGCGAAGATGTACTTGTGCTAGGCCCCACGCACGAGGAGAGTGTTACGAGCCTCGTGGCAGCTCATTACAATGCAACGGGG
GCGACGAATTCGTCTCTGAGACTGTACCAGGTCGGCCGCAAGTTCCGTGATGAGATCCGTCCTCGATTTGGTCTCTTGAGAGCGAGAGAGTTTGTGATGA
AAGACATGTATTCGTTCGATGTGTCGTACGACGGTGCGTTGCAGACGTACCAGGACGTGACAGATGCGTACAATGAGATCCTGATCTCGAGACTCAAACT
GCCGGTGAAACGCGTGGAGGCCGATTCAGGGAACATTGGTGGCAATCTGTCGCACGAGTTCCACGTGCTGGCGGATATCGGTGAAGACGCGATTCTGTCC
TGCTCGTCGGAGGAGTGTGACTACGCGGCTAATGTGGAGAAGGCAGAGGGGTTTCTACCTCAGATGCCGATGGAACACAGCGGTGAAGTTTTGCCAGGGC
TGAGTGCCATCATTGCGCGGCTAGAAAGACAAGCTCTTGCTGGTGATTCTCAGATGTGGACGACTGTCATGGAGCTTCAGGAGGTTGCGCGGTCGCACGG
TTTCTCCGTTAAGTATGTACACGAGCAGGATGATCTGGCGGATCTTAAAATCGATGACCTCGAGACCAGAGCGCAGCCGCGTGTAGCATTGTGCTTTACT
CGACATGACCGCGAAGCGAATGAATTGGCTGCCAAGCCGTTTATTGGCGGTGATGAAGGCGAGGTGGTCACGAATCAGGCGAAGATCGCCGACCTGCTCG
GTAAAGCTAATCCGAATGCTGAGCTGCATTTGCTTCTGGATGATTCCCTAAAACAAGGTGATCAAGCCTCTCCAGCTGTGGAAGCTCTATGCGACTTTGC
AGAAACGATATCAAAACAGCGTGAGAATATTCACCTAGTGTGGGGACACTTCCGCTTGGCACAAGCTGGTGACTGCTGCCCACGCTGCAACGATGAGAAC
GCAGTGCTTGAGGACAAACGCGGTATCGAGGTTGGCCACGTTTTCTATCTGGGACAGAAGTACTCGAAGCCTTTTGGCGCGACGTATACGGAtgccaaga
acaacaagcACCCGCTAGAGATGGGCTGCTTCGGTCTTGGTGTTAGCCGATTGGTTGCCGCGGCAGTCGAGGCATCACACGACGACCATGGTATTGCGTG
GCCGACTGAAATTGCGCCGTACAAGGTTCTTGTCATGTCCATCGGCGGCAAGAAGCGAGAAGATACCGTGTCCCAAGCTGCATGGGATATTGCTGACAAA
CTTTCATCCGGTAACGTTGCCGGCCTAGTGAAGGAcgatgtgctgctggacgatcgCTGGCGAGAGAGTCCTGGCTCGAAACTGGCCGAGTCGGAGCTCA
TCGGATACCCCTACCGCGTCGTTGTGGGCAAGCGGTTCACGAAGGAAGGACTCGTGGAGGTACAGAAGCGAGCTACAATGGAGAAGACTTTCTTGGCTCC
CGATGAGCTACCAGCATTCTTCGCTAAGATCGTTCAAACAGGCAAATTCTAGCTGTAGACGACAGTTACTAGACAATAAACATTTGTCCATTTAGTGTTC
TGGAAGGTGTTTACCGGATGCCACTACTGTAGAACCGATCTTAAACTTTATAATGAGACGTCAAAGATGTACCGTATTGCATATCTTAATTAATATATAA
ATATCGCTATTAGGAAAAGTGTTTTCAGTGCTCACTTTGAAGATTTACTTATAAAAAgcatttttatttttcattTGGAAAAACAAAACAAGAATGAGCT
TATCTGTCGAGCGGCTCGGCAACGGTTCCTCCTACTGCCTGCGTGACGAGCTTACGGGCGTCACCGTGCTATTGGGATGCGGCGAGGCGAAAGACGTGTC
CTTCTACTCCTCGGACGATGCTGACACTGAGGATTTTGATGCGCTTACGACGCAATACCGACGCGAACTCAAGGACCTCCTGCGACGCGAATGCACTCTG
GACGCCATCCTGGTGCCAAACTACCGACCTGGATCCTGCTACATGTTACCCTACGTAACTGAGAAGTGCGGTGTGTCGTGGGTCGCTCCATCCACCGGCG
CAACACAAGACCCGAGCCAGAAACAGTCTCCAGCTATCCTTATGACACACGGGACGCGAGCTATTGCACCACATCTCCTGACAGAATATTGGTAGGGGCG
AGATCGTAGGATGTATAGCTCATGTATTTAAAGTCTGAAGGCGTGTGTTTGATACTGCAGGGCTGGATGCCATgggaaggtgaaggagggAGGGAGTGGC
TTGCCAGCTTTGTACGACGTTCAAGACATCGCCCCAAGCTTCAGGAAGGTGAAAGCGCTAGCGTTAAAGGCTTGTGTGACAGTTAACGACCACTTAAAGG
TCACTGCTTATCACGCGGGAGATGTGGCGGGCGGTTGTGCCTTCTACTTGGAAATCGGATCCACAACGGTTCTATTCGCCAACGATTTTAACCTCACGGG
CGGACGAGTGCTGCTACCGGCACAGATTCCGAGACTGGAGCCCAGTGCGTTGATTACTCGGAGCTCATTTGCTGTGACGGTATCGGAGACGCAGAGTGCG
ATGGAGAGAGAGCTGGTGAAGGTCATTCTGGAATGCATCAGTTCCAACGGCAAAGTGGTGATACCGGTGTACCGGTTGGGGTACTTTCACGAACTGATCA
CAATTTTGCTGGATCATTGGCAACAGTTGAAGGATGCCGCTGGGAAGGATGCGAAGTGTCCAATTTACCTATCGGATGCGGCAATGGAATACCCGAGTAG
ATTTCTGCCTCTCTTGTCGAGAACGTGCACGACTGCTGTTCAGAGTCTGTTGCGTGAAAAGAACCCAAATGCTGCGGACCTCCAAGCGTTCGattggaag
aagctgagtCAGCCAGGGCCGTTTGTGTTATTCACGGGACCCGCGAACATTTCTCAGGGCGACTCGTTGCGTGCGATCAAGGCGGTTGCGAGTGATCCGA
AGAACCTTATCGTACTATCGGAGTACTGCACACCGGGTACAGTCAACTACTTGCTTTACGCTGATCCTGAGCGCAAGCGCGTCAGCAAGCGCCTCGGTGT
GAATGTCGAGTGTGGAGTGCACTACCAGCCTTGCGGAGATGAAGTGGACACGAAGAGCATCGTTCAGCTCGTATCGCGAGTGGCTCCGCGCCAGGTTATT
CTCGATTACACGATTCCAGATGACCTGGAATTTGTCAAGACGCACATCCAGAACCAACTGAAGATGGACCCGGCGGTCGACACTAGCGTGGTAGTAAAGG
GGGTTAATCCTGCAGGACGTACGCCTATGGAACCTTCGCGTGACATTCCACTGCGCATTCACAAGGCAATGTTTAACAACCCTTCCGATGTGCAGGGCAT
GCTAATTGCCGAGCCTAAGCGGAAGCTTATGCTGGTTTCGAGTGGCAATGGCGCAAGgcgactgaagaagaaaaagcacTCGCTGTTCTTCTCATACTCT
TGGAAAAAGCCATTCGAGCCATCTCCTCGCGTGAAAAAGAAAAGTTCTCGTCCGGCGTCTGCCTTATCTTTTCTcttgtctgctgctgtggagtctgctg
atgaagaggaggagagcgagcAGCAACCAGAAGCGGACGTGAACCAGCTGTTAAAGGTATTGGAGCTCAGTCTGACCAAGTGGATTCGCAGCCTTCCCAT
TGACAAAATTGATCGTTGGCTGAAGCTACGCACAGTAGGGGTGTCAGTATCTGCCGAGTGGGAAGTTCACATGGAATGGTCGTatgacgacgaagctctC
GCTGGACGGGTGCTTGGGATTGCGAAGCAAGTAGTTCACGAAGAatacaagaagcagctggcAGATTAGTGCAATACTGAAGGATGAATGCCAAGCTTTT
CGTCTAATTACTGGCGTGCTGGCTTTCCTTCGCCCTAAAGAACTGAACAAGTTGCGAATATACCTGCCCAAATGACGTCGGGGCTTGAACACGCTTCTGA
ATCCACTCAGGTAGGCGGCTACGAACTACAGGATTTGAGTATCGATGATCAACCAGCAAAATGGTGGAATAGTCCTTCTGGTGGCGAATTGATCGCCCTT
CACGTAAAGAAAACAATATGTTAGCTACTACCGATATAGTAAGGAGAGTTGCCAAGACTGGGCGTACCGATGGACTGGTTAACCGCCTTCATGCAAAGAC
TCTCGTAGAACTGCCGTCCAGATCCGGGGTTTCTCTTGTCCAGGAACGTCATTTTCTCGACGAGCTCGGAGTCTCGCGCGTTCGGATAAGGCATTCCCAC
CATCACAACGCACCGCGCCAACTCGTCACTGAAATTGATTCCTTCGGACATTTTCCCGCCAACTACACTCAGCAACATAGCTCCACTCCCATCCCGATTG
CCTCGAGAACATGCGGCTGAATAGTGCATCAAAACCTCTGCCAGCTCATCGGATTTCTTTGGCTCTCTGAAAATGGCTTTCTTCGCTTGAATTTGCTCGT
ACTGAGCTGTAGCTAACCATCGACGCACCACATTCTCTTCAAACCGGTACGAAGGGAAAAATACCACAATTCCCCCTGGCACGATACGCGATAGATTTTG
TAGGATCCGACcgagttcatccagcgcttccatGTCATCTCGTCGGGAATAAGTAAACTCGAGGTGTTTCTGGGAAGGACCCGACGCGAGGCTGAAGCCC
AGCAGATTCTCAGGTGGAATGACGTGTCCGCACGAGAAGAGGTCAATGTGTTCTTTTGGCACCGAAGCGAACAGTTGGTTAATCACTTGGGATACCTAGA
AACGACGCAGTTAGTCCGATCCGTAGTACTAGTGTACAAAATCAAGTTTCCCTTGTGTCTTCGACTTACCGGCTGCATTGTTCCTCCAGCGAGAATAACA
CTACGTGCGTTTTCCACTATATCTTGAAAGTGAATGACCGGATTCAGCAAAATAAACCTGATCAGTCCCTCAACACCCTTGATCGCCTAATCAGAAGCAA
TTAGCACTAGTACAAACGGAACATCACCGCCCTTGTCTGCCGTACATTGCGTGGCTGTGCCAAGATTCGgccgtctcctcctgcacTGGTCAAGGCCTTG
AGCAACGCCTCAACTGTCCGCAATGGCGAAATGTGACGACTCTCAAAACCTTCATCAGGGTCATCAGTAGAGGGAGGggcagaagcaggagcacAGGTAT
GAGTAGAGTCCACAAATcccatcagcttcttcgccaggCCACTTTCACTTAGATATTCCAAGATCTTGAACATATTGAAGTGGTCTATCCGTGCACTGAA
CAAAAAATCGTTGATAGTCATCATCTGCgcgccatcgtcgtcctctGTTGTAGCCTTTCCAGCAGCCTTGCTCAGCTCACGAAGGAACTTTGTCAACAAC
TCCAAAATCGACAGCAGTTGCTTGATGTAGAACgcgttcttgcccttgaaTCTTTTTTCGTATTTTGAAAAATATGACCACAGCGTTCTTCGCGCCACCA
CCAGTTGTTTACTGGTGATCTCGACCTTGTACGTGTTGCTAATTGCATCGATGATGTTGTGTGCCTCATCAAATATGACAATACTATTTTCCAAGTCAAG
TCCAAGAGTTTCTCGCGTACCTTTGCTGAGCAGCATCGAGTAAGGCACCGTGATAATTTGAGCGAGTGGGATACTCTCACGAGCTCCGTAGTACGAGCAA
ATGGACATTTCCTCGCCCAATGTGTGAAGATCCTCGATATCTTGCACGTGTGCCTAGATAAACAACGTAGAATAGCGTTTTAGAAGGCGTAGAGTAGCGT
CACTAAAATCACCCACACACTCACCAGGGCATAATCCTTGTAGTGACCAAGCAGTTCCTTCTCGTAGAACGGGCATTTCCCGACCTTCTTGCCGTCATTG
GTCTTGTTGCTCTGCATCATATCCAGACACTTGTCGGTCATTCTTAAGTCCGAGTTGAGCTTCGTAACCTTCGGGTTGACGCACAGATTCTTGCGAGAAC
CCAGAGATACAACACGGATGCGCTCCGCAAACGCAGTTTTGCGTATCTCCCGGACAAACTGCGAGATCTGCGAGTGCGTTCGACTGCAGTAAATGATCTT
CacgacgccaaagtccgccttctcctcgccatAGCGTCCTCCCGTCTTCTCCCCACTCTCGCCGTCACTCTCGCTGTTGCGGCGGGCCACTCGATCACTG
TCGTACGGATCCACCAAGTgctcctctccttcctctccaTCCTGCTTGCcctctcttcttcctgtttgGTGCAACCGCTTCCGTCCGTTGTGGTTGTATG
CGATCGCCATCTTGCGTTTCTTGGTGGAGGCTTCAGGCTCCAGtcggagcttctcgatgccagccagcgcctccttcaccacctGCTGGCGGAACTTGAC
TTCTCGATCTGCCGTCTTCTGCTCAAAAGCATCCAGCCAGCTTGGTTCTGCACTTTTCTTGGTATTAGCAGCTACTGTGGGCGTTGTGCCAGCTTTTGCA
GCGCCTTGTAGCAGTCCGAACTCGTCCGTATGGTGTGCCAGCCACGTTAACGTCCCGCAGATGAGGCTGATGGACTTGCCCGTGCCTGTCGGACTCTCAA
AGATGCCGCAATGACCTTGCTCCAGTGTCTCCCAGATCTGCCGCATCAGGTCCAGCTGGATCGAGTACGGCTCGTACgggaacgagaagaaggcgccgtC
CATGATGCAGCAACTGCTATTTTTTTACTTTTACTTTTTTGGAGTTTAGCTCACTTTCTAAGGGTTTAAAATTTGAGAGTTTAAATATACATTAATGTGT
AATATTAAGACTTCTATTAATATTGAAATTATAAATATATTAGTTTTGCTATATTTTATTACAGTAAAATGTTAATTTATGTAATAATAATAGTAATTAC
AAACAGCCATAATTGTTTTCGTTAACAATTATTGAACACCTTTGTGTGTCCAAACTCGGACAAACGTGCTATCAAATCCGTAATATGACATTTGTCTTAG
TGCAAATATTCCGTTAAGGACCTCAGCTCAAGATTCAAACTCGGAAAATGTGCAATCAAAGtcgaaatggctacagccCGTACACCATGTCTTCTCCGGC
AGCCGCCTTGTTCACGAAGTCGTGGCAATGAAGCTGCATACTTGTCACCAGCGCAGGCGTAATGATCTTCATGTTGTCGTTGGCagcacgctgcagcacc
cgCATCTGCCGCGCTGAAATGGCTTGCACCTCACCGTTGGCATCTGACTCCCGCGAGCGGTTGCAGATTTCGTCGTGCTCGAGGGCCAGTCTCCTCTTGA
TCGCCGCCTTGAGCACGCTGAAGCAACCCTCGATTGGGTTGCACATAGGCGAATACGGTCCAAGAcgtagcagcttcatctcggcATGCTTCGCAACGCG
ATCTTCAGTCTGTCGATGCACGGGAGCGTTATCGAGGACGATTACAACCTTTTCCCCCAAAAAGAAACGCTTGTAGGTGTCCGAGGCCTTCACGGCTTGG
TAGAACTCTTCCATAAAGGCAGCATTCTTGTCCATACGAATGCTGCCACGTTCTATGCGGTAGGTAACCAAACCAATTGATGAAGAAACTGCACACTGCA
CTTGAAGATTCGCCCCCATCTAAAGGCATCTTCACCACAGCGCGCTCTCCCCGCAAAGCCCGCCCGCGTTGACGCTTCAGATAAACGTTAAAGTTAGTCT
CATCGTAGTACACGATACAGTTACCTTTCCGCTGGTGCTTTAAAAGCTTCTCTGCAAAAATGCGACGTTTCTCCTTGTTCACATGATTGTTGCAAGTCGT
AGGCTCGATACGCACTTGCTTGTATAGCATGCTGATAAGGTGGCGACTAATGGTGGACGTATGGACGGCAATGTTGCAGTCAGCTATCAGCATAGCGCGC
ATTGCAGCTAGCGTGGTGGTGCAGTCATCGTCGAGGTATCTCTCGAGGCATGTCTTGGCCTCTTCCGTCAACTTGGTGTTCCAGCGCCCGCCGCGGGGGA
GGTTCTCCGCCCGTCCGCGCTTAACGAGGTCGTAAGCAGTGCTCCCAGCGATCCCGTTGTAGGCAGCAACAGCTAGCCAGTTGCGTCCAGCGCGGTGTGC
GTCTAGGACGCGCTGTTTTTCGATGACAGAGTGGCTGGTAACGCGGGACGGGGACTGCATTTGCGAGGCTGGGAAGGAATTGAAAACTGGCAGGCAGGGG
CACGAAGAGCACCAGTTTCACCATTAGCTTCGCGCGCGCAAAGCTTTACACGCTTTGAGCGCGCCTGTTTTGGCGGGAGCGCAGCTGCACCTCACCCGAC
TTTGATTGCACATTTTCCGAGTTTGAATCTTGAGCTGAGGTCCTTAACGGAATATTTGCACTAAGACAAATGTCATATTACGGATTTGATAGCACGTTTG
TCCGAGTTTGGACGCACAAAGGTGTCGTGTTGTGTCTGCGACATGAATTTTTCCATATCGAAGCCGTTTAAATTACCATACTGTAATATACTACTTCAGT
AGAGGATTGGGCTGATAGCGCTAAACAAATAAGCCTTGATTCAAACCGCTTGAATACTTGCGATAGACGGTAGCAGTACGAATAAATACGAGTAACACTC
AAAGAAAATGCACTTGCCTGCTTAGACGTCGTCAGCGCGTGCCAATAATTTTAGTGGTGGGTGCATCCGACTTTGCCACCATCTGTGTATATCTGAAGTC
AAGTATTCATATAGAGAACACACAATTGAATCCTGCAACCACAGGCGGCACAAGAGGCCGCGCGGCGCGGCGTAAGAACGGCGTTTCTCCGGCCATGACG
TCTGCTCCAGAGCCCAATGAGCGCTGCGGCAGGGCTTATTGACGGCCCGCAGATCTTGCGCAgttgtcgccgtcgtcgaaTGCTGGTAAAGCCGTCATCT
GACGAGTGAAATCGACCGGAAAGGGCGGCGAAAATGCTGCCCAAAGGTAAGTCGCGCGCGCGCGGGGGGCATAGAGGGCTACGATGGAGGGCAGTCCGTG
CTACACCATTGCCCGTCCAAACTGGGATTAAATGCAAGCAAAGTGGGATGCACTTTCTGGTACATG