Description :
From Genome Similarity Track
Location :
Scaffold_164:12433- 16244
Sequence
3811 bases(100 bases per row)
GACGAAGAATCCTGTCAACCACGGCCGCGCCAAGCACATCGACATCAAGTATCACCACATCCGTGATGAAGTCAAGCGCGGTGAGGTCAAGCTCGAGTAC
TGCGAAACGACTCTGATGTTGGCGGATATCATGACCAAGGGACTTCACGGACCGCGTCACAAGGACTTAACGACGGCACTCGGAATCCGTGCGTGTTCGG
ATTGAGGGGGCGTGTTGAGGGTTACCGGTTTCAATCCGAACTTTAAGGTCTAGTTCTTACGACATAGTTCTTACGGTAATTACCTCATAGTTGATTAGAT
GAGTAGCTTGATTGGATGCCACATGATTTATATCTGATTCAAGATATAAATCAGTCGCACCTGATTTATCTGGATCCAGATAAATCAGGACGTAGGTAGA
ATAAGCTCCACCAAATTAATCACTTTCGAATCCTCTCTCAAGTGAACAAGTGTTCTTCGCTCCGTTCTCTTCGGTCTCTCCACTCCGTCTCTTCTTATCG
CCTCCCGCTCAAATAACAACAGGTATGGTTGGCCGCGCCATCGTTCTCCAAAGTGTGCAAACGCCTAATTTCGTGGAAATTAGCTTCCCTCAATTCGTAC
AGGACTGAGGTGTATATGGCAAAAAATCTTTAATGAACCGGCTGTAGCATTTCAGGCTCCCTAAGAAGGACTGCATCGACCGCAATGAAAGGGAAAGGGA
ATATTGATTAAGGACCCTAAATCCTTCGGGTCGGTCGGCTTCTATTCCTGATATTGACACTTGGTTCCTGAGATACTGGACCTTGCGTCGTCCCCAAACA
CTCTCAGGTATGGTGATCGACAAATTCCACTGATCACATAATTCCAACACTCTGTTCACCTTTTGATAGAGGGACGTCCAGGATGACGCCAGGATCAGAA
TGTAATGACTATACGACCTCCGTCTTTAAACAGAAGGCCTTCGGTGCGGGTTTGCATCGCCGTCTGTAAACACATCGACCGGTCGAGACACCTCATGATC
ACTTGACCTCTGCCGATCACCGATCGTGATATACCCATATAATTCGTTATCCACCATACGTTGATATATCTGCGGAGCGTTTTTCAACCCGAACGGCATG
CGTAACCATTCATATAGACCCTAAGGCATAATTAAAGCGGAGATCTTTCGTGCTCTTTCTGTCATCTCCACAACTCAGAATCCCTGGTCATTTCCAGTGA
ACAGTAGTATAGCGCATTTTCCAGATCTTGCAAAAAATCGTTGATTATGGACATGGGATATACCACAAGCCTCGTCAATTCATTAACTGTTAGGTGGTCA
ATACACAGTCGTATATCCACCCCATTCTTTTCCACGACCACGACGATTGGTGACGCCCATGGTAAAGTAGAGGGACAAATTATTTTGGTCGCTAGTAACA
TTTTGATCAGGTCCGCCAACTTTTTGCGGGAATATGGGGCGACTGGACTTACTCGTTGTGCTATTGGAGTTGCTCATTCAACATCTATGTCACAGATGAT
GCCTAGTGCGGTGAGTGGTAGGGCATTTAATTAACCCATCAGGAAGTGTCGTTTCTTCCAGATCAGACGACGTAATTCTTCTTGCTTCTTGGTTAATGGG
ACTCCCGGGTCGCCCATCGGTATGTCGTCAATTTTTACCTCATCTGGCCTCACATCCAATTCCGGTAAGACTGCCATATGTTGTCCAATATCCTCTGCAA
ACAACACTCCACCCTCATGATGATATGACAAGCGTTTGCGTGCTCTTTCGCTAGCGATCGATGTCATTTAATTAGTCTGCTGGTCGGACGGTCGATTTAC
AACACATTCTTTGCCAGTGATCACGTCTGGGTGATGGGTGGACCGGTTTCGCACGCGATCATACCCACTCTCACTGTCCGGCTCGGGAGTGAGTTCTTCC
AAACAACGTCAAGTTGTATTTCCGACTGGTCTTGCACCATCGCGACGTCTTTGATCACATCGGGGGCGTTGTTCACATCGTTCATTACCGGCGGTCGCGC
CAATATCTTTATCTCGGAGTCACTCTGTTGCTCCGGCTGACCAGGCACCGAATCCCAAACCACATCACTATCATCACCATCACTAGTCTTAACAGGTGTG
GTGATCACGTTGATAACCATCGGTGGCTGTCCTGAGTGTCGCCTTTCGATGTCATCTTGTTTGTCTATGTGATCACATATCGGCGTATCACCTTCTAGAT
TTGCTTCTTCTGTTTTCCATGGTCGTTTCTGCTATATCCTTCGGCGGTCGCTTTAGAATCAGCATGGCACTCGGCAGTAGCCTCAACAGTAAACGTTATC
AAGTTGCCTCGTCTTGAACCCATTGCAACTATCCGTCCGCACTTCTTTACGACGCATCCATCGCCAGAGATCTCGACTGTCATTCCGCGTGATGTCGCTG
CAGTCAGCGAAAACAGTTCTTGCTGAGATCCTGCAAGTGTAGCGCGTTTTCCAGCCGCGCGTTGATCCATGCGGTCCCATTTCATATGCGCAAGCTCACT
GTATCTTGTCTGAGCACTTTCAGCTGCGCACTGTTCTTCACGCTGAATACAGTGCTCACCGTCGTTGTCTTGTGTATTCGACGAATGCTGCTCGTTCCTT
GCACATGTGAGGCGTTGCGCCGCTGTCAATAATACAGCAGTCCATCGCGCTTCCTTCCGTGACATTGAACGCTACATTCGAATGTTCGTCGCTTCTGTCG
CCATTCTCGCTCTTCCTCGCCCAGCAGTCGCGTGCGTAGTGTCCGCGCTTCCCACAATTGTAGCACTGGACTTTCGTATCATTCTTGCGCTGCGAATTCC
CGCCTTTCTTGCCAAACTTGGTCTTCTCTTGGCGTCGACTATCATGTAGCGCAGTTGCTTCCTCGATGCGCGACGAATCCTTTTGTCGCACTTCCTAAAA
AATTAGCTTGCTAACGAGGTCGCTGAAGCTAAACTGCGTCACGCTCATGCGAAAAGCTTGAAACAAACTATCAAAGTGCAACGGAAGTCTTCGTACCACA
CACATCGTCCTCGCTTGGCGGACATCCGACTTTCGTCATATCCAGCACGAGTCGCTCCAACTCGGTCACATGCGGGCTCATGGTTGTCACCGTATAATTG
AAAGACGAGAACCGCTCCTTGATCCATAACTGGCTTGCCATGTCTTGGGTGTGGTGAAACTTCGCCAAACCACCCCACGCATCTCTTCTGTCGTCGCAGT
GATTACATGCATCAGCTGGGAGTCGCTCAGGTTGAGGATGGTCGCCGCATGCGCCTGCTGCTCCTTTCTGCTGTGACCAGAGTTGCATTGGACACAGCCT
CCCATATTCCCTCGGACATGAGATAAATCCTCATCTCGAACGCCCATAACGAATACTTGGTCCCGTCAAACGGTTCCAACTTGGGCGCGAAGTCATGGCT
TGAGCTCACAACCTGTCGAAGTCCGACCGAAGATGAACTTAAGGCAAAAGGAGAAAATTCAGAAGTGAGTTGCATTCTGTGAGTGTTTCCCTACCGTTAG
TACTTTATTAGAGCTACACTCGTTCAACTTCTCCCTGCTGTTGTCGTTTCTCGTCTCGTCGTCTTTCCTGGAAACCGTTCACTGTCGTGTCCCATCTCGT
TTCGTCGTCTTTCCTGGAAACCGTTCACTGTCGTGTCCCATCTCGTCTCGTCGTCTTTCCTGGAAACCGTTCACTGTCGTGTCCCATCTCGTCTCGTCGT
CTTTCCTGGAAACCGTTCACTGTCGTGTCCCATCTCGTCTCGTCCCCTTTCCTGGCGCCCACGGCGATGTCGAAGGTCGAATAGTCTTAGTCGACAACAG
GACTTTTATCA