Description :
From Genome Similarity Track
Location :
Scaffold_1236:1243- 5122
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1236-fgenesh-gene-0.0Conserved gene of unknown function
Pytar_ATCC12531maker-par_contig_1236-snap-gene-0.7Isoform 4 of UPF0533 protein

Sequence
3879 bases(100 bases per row)
CGAAGTCTCGCTGTCTCCCAAGCAAGCGTACACAATCGGCAGCTCGCCGTGGTGCGACGTACAAGTTGTCTCGGACGGTATCTATGCTGTGCACGCACGC
ATCGTCTTTGACGGCCATTTCTTTGTGCTGCAAGATCTCTCGTTCGAGGAAAATCCCAAGCGCAAGACCCGCGTGCTGCTCACGCGCGCGACGCGCATCT
GTCGAGGCGACTGGCTGCTGCTGGGCAAGTGTGCACTCACCGTCGTGAACGTCTACCGCGCCTTCCGAGAGCACGAGCCTGACTTGAGAGAGGTCGTGTT
CAAATGCCATTTGCTGCGCACGTCCAAGCGGAAGAACAGGCGACGCGAGAGCTTCCTTCCCGTGGGTTTTAAGCACGCGGGCCCAGAGCCGTTTGTGATC
GGCAAGGGCCACATGTGCGAAGGCCAAGTCACCACGGCGACGCTGACCGTGGAGCAGTTCCTCTTCCAGCTCGACCACGGCCAGTGTTCGCTTACGCCGC
GCTTCGCCGGTGTGAACCAGGGTATGTATTTTTTGCTGGGCCGCAACGCGCTACTCCACGAGACGAAATACAAAGACGACGTGATCCGGTCCACGAGCAA
GGCGCTCATGCTGGTCGAAGGATGCATCTTTCGCGTCGGCAGCAGCGAGCTCGAAGTCACGTATGTGAAACTAGAAGACCCAGCCGAGGCCGTGACGCGC
ATGGAAGAGATCCGCGACAATACGCAGCTCCTCAAGACCATGCCGTGGCTCCAGCAAATCAGCTTTGACCGCCACAGCATGGAGAACGTGGCGCGGCGAG
CCCAGCGGCTCGACCTCGAAGCTGGGGATAGTGTCTTCGACGAGGGCGACCCCGCGAGCTTTCTGTTTGTCGTGATCGACGGCGAGATCGAGCTCTCAAC
GCCACGCAAGACTACCACCACGAATCGTGCTGGTCCTTCGCTGCGCGGCGGCTCCATGCGGCAGGGCTCGAGCAATTCGCTGACCGACAAGAGCGGGAAT
ATTGAGAGAGAATTTGTTGTGGAGACAGTGGCGTCGGGCAGCTACTTTGGCGAGGCTTCGCTATGGTTCGGTGAGCTCGACTATACCGAGTCGGCCAAAG
CGCTGACGCCTTGTCAACTACTCGTGCTCAGTCGCGAAGACATTTGCGGCTACTTTGCGTCCTATATGGACATCATTCGACCGCACGTGAGCTATGAGTC
CCACAAAGACTTGCTCGAAAAGCTGCGCGTGTGTCTACCGTGCTGCTGTGCAATCTCCTACCAAGACCTGCGGGTGATCGCATCCAAGACCGAGCGGATA
TACTACCAGCAAGATGATTGGATCGTGCGCAATGGAGAGTTCACCCACAAGGGTAGACGCCGCCACGGAGTCTTGCTGATCCGATACGGCACGGTGGACG
TCGTCTCGCCGGATGGCGACCCCATCATGGCTCCAACAACTCGACCAACCGACGATGCTCGTGACGACGAGAGAGGAGGAGATGCCGCCACGGAGGAACG
GCAGACGTGGAGCGTGAGCACGGCATTAACGCTTCTCCCAGATCAAGCACCGCTGTTCTCCAACTTGAAGGCCCGCACTGGCGTGCAGTGCTTCTACGTC
GACCTCTCAGTCATCCGCCACTTATTGAAAGAGAGTGAAGTGCGCAGTGACACGGCCCGCTCGCTCACCATCAAAAAGGCAGTGGCACCGAGTGCCCCGC
ACTCGATGCTGCGGCGTCGTTCGACCAATCGCAGGAGCTCGTACGGCACACCTTTCAAGGCTCGCCACTCCCAAGTCTTCACCACGGCGCTGCGAGCCAA
CCAGGGCGGGGACGACAATGATAACCTCATTGAGAATGCTGATCTCGAGGACGCGAATGACCCGTCTCGTAAGTGGCGCAGGAAAAAGCGCAACAAGAAC
TTGCTGGAAAAGACAATCGTCGAGACCCAGCAAAACGCTGAGCTGCTGAATGCACTCGTGTTGTACGTGTTGTCGGGCGCAAACCGCGGCGACATCCACG
TGGTCCGCAATGTTGCGACGATCGGCTCGCTGATCAGCGCCGCCGACATAGAGCTGAATGACCAGTACGTGTCCTCACAGCAAGCTGTGATCGAGCACCG
AGAGGGACGGTACTGGCTGTACGATACGTTTAGTGAGTGGGGCACGTACGTGCGGCTCGAGGAGAACCAGTCCGTGCAGGTCTTCCCCGGAGACATCTTC
CTCGCGGGTGAGGTCGAATTCACCTGTATGGGCGCGTTCCCCGAGCGCAAGAAGAGCTCGCTATGCTGCATACAATAGACTGCACAAAATAATCAACCCA
CTCGATGACAGGCATTGGTTACCAGTACCGTGATGCTTTCTACGCGGCACGTGGTGGTGGCACGTGGACCATGAGATGCGCGAGCGCATCCTGTCGGAAC
TCTTGGTTGGTTCTCACGTCCACGCAGACGGCACCACGAAGGACCTGCAGGCCGCCGGCCGTCGGCAGGAATTCCACGGACAACGTCGTGGAGGCTTTGG
CCGTGAGAGGAGGCAGGTTCTGTCAACAGAGGCACATCAGTCAGTCACTTGGTCCAGGTCCATGCAGTATCAATATCACGCACCTGATGCGACACGGACG
AGCAAAAGATGCCGCTCATGTCTTCCTTGCGGAACTGGAGCTGGAGTTGCACTGTGCGCGCCGAGTGGTTCGTGACTACGACGGAGCCAATGAACGGCGT
TCCGACCAGCGCCGCCTTGGGGAGATCCGAGAGCGTCACGGTCACTTCGCTCACCGGGTCGGCCTTGCGCACAACGGGCTGACTCTGCACCGAGCCGGCT
TCGCCCATCGCCGTTTTCCACCCAACGTGAAGACGGCCGAGGTTCTGGGACGGCTGTGCAGTGCCGCTTGCGTCACCCGCCGCCGCTTCGTGGGAAAGCC
GAAACACGCGCTGAACTTCTTCCTGCGGGTTGAGCATGGTCTGCGGGCCCATGAGCAAGAGTTTCTTGACGTCGTCCATGTCGTTGAGCTTGCGGGACGC
ATCAGCATCCACGTCAAACTCGCTCGCGCTGAACGGCGCGACGGCCATGAACCGGATGCTGTCAATAAACAACGGCAGTTTCGACACGTTGCGGATTTGC
GCCTCGACAAGCGACTCTTCGGCAGACTGCTTGGCGTGCTTGAAGCTGATCACCAAGGGGTTCTGCACTGCGAACCGATAAAACTTGCGGATCGACTTTG
GCTCGTTCGTGACCGGATCGACGTACGACACGCCGACGCGCAGTACGTGGTTGCCCACTTGGTTCAGTGGGTAGTCCACGACCATGTCGAGACTCGTGCC
GGCGGCGAGGATCTTGACGGGGTTGGGCGGCGCGGCGCGGCCCGTGCGCGTCACGCGGTTGTCGTGGAGATCCACGCGGTCGTTCGCGCACTGGATATTG
GCGGTCAAGCCGACGTCCCGCAAGTCACACGTGTACTGGTTGATCACACTGATGTAGCTGCTGAACGTGTTGCCCAGAAAGATCTCTCTAAGAAGACACA
GAAAACTTCAATGACCTTCTGGAGGCGGTATCTCACTCGTGCGCACAAGCGTACCCAAAGCTGTCGGGCAGGATGAGCATACTGGACATGGCAAACTCAT
GCTGAAGCGCCGTGGACATGGAGAGCGTCGTGGGCATGTGCGATCCGGACGTCGGGCCGTGTGTGTACAACTTGGGTTTGTACAGACGCATGACTAAGGG
AAAGTCATCAGGCTGAGCAACGGATTTGCGTAGGATTCAGTGCATCAATTCGTACCTTTCAAAGTTGGCTGGATAGGCGGCGATGAGCCGGTTGAAGTGT
TGCCACTAGTGGAGCCATTGCCGCTGCCCGGGGGCTGTGGAATGCCCCCGCCGGCGCCGCCGCCGTATTGCGAGCTCAT