Description :
From Genome Similarity Track
Location :
Scaffold_205:1243- 3567
Sequence
2324 bases(100 bases per row)
GATACATGGGCTTCTAGCTTTATTGCACAACAAAATGTGTAAGCTCTTTCTGCCCGGGAACCTTGGTATTCTCTGTATGTTTCCATTCTTCCGATATCAT
TTGCTCTGAGTAATTAATTTTACGTTATGAGATCTCAATACTGAAAGATGGAGGCGACTACACGCCATATGGGAACCCACTCAAGATTTTACGATCTCGT
CCTCCCAACGTCGATCCAGTCCAGTTTTTAGAATTTATGGAAACAGCGCAAACAGCGTCAACCTCGATTTGGAGCACGCTGGAAAGTATTCATTAAAACC
ATTTTAGCGAGAATGGTAGCTGGTCATTGCCATTTGGACATTATGATCAATTTTTTCTTTTACATTTCTCCCGTCCGCATGAAGCCTGTGTCTGGTATCC
CGGGTTGGGACGCACTACTGATCCTGCCGATCCGATCGATGCAATAGAGGTCGCCGATCGTAAGGAAACATGGCGCATTCAATTTCGCAATATGATTCAA
CGTCACCCCGGTTGACTGAATCCTTGCTCCCGTAATAAGTTTAGGCTCGTTAGCCCGTCTTAATGTCAGATCGTCATGTCCTTGAAGCGTCCACATAATC
GATAATCAAATTTTCAGTTTATCTTTGATCACACATATTCATCTAAGTCTGCTCACATCGTTCCGATCTCGACCTCCACGGATAAGCTAGTAATCCGCTC
ACATCCTTATACACAAACAAAGAACCTCGTCCTCCGGCATATGCCACCACCTAGCACATCCTTCACCCCCTACTCAGGGCTCTTCCGAATTACTTTCATG
CAACTGCATCATTTTACAAAGATTTCGACTTACCTGATCCCTTTTAAACTCCAGCAGGAGAGCTCCACATCTCAGCTCAGCCTCTTCCACCAAACTCGGA
TCGGGATATCCTTCCCATTGGCCCAAAGAAACTGACAATGTACCCGCCCATAGCGAGTTTTGACCAGATTGCATGTCCATTATCATATCCACTTCGAACT
CGCCCTCGTCGAGATCGCCCTACCAGCTGTCTTCTGGCAGTAGATCTTCGTCAAAGTCGAAGCTATCTCCTTCCTCCTCCACCAGCTCGTCTTTCGGCCG
TTCTAGGAGAACACTTAACCGTTGCACGATCGGAGACAGTCGATAAGGGNNNNNNNNNNCTAGGAGAACACTTAACCCGTTGCACGATCGGAGACAGTCG
ATAAGGGGTACCGGCGATATCTAGTCGTACTGCGTGATCACTACACATTTCCACTACCTGAATAGACTCATGCCACATATGCGCCAGCTTCCTCGCATAT
CATCCTATAACCCGGTCCAGATACATCCACACCTGCTAACCTGCTTCAATACCGTGTTGGTCCAGATCTTCATGGTGTCGATCTGCTCGTTCTTGTATTG
CGGCTCTCAATCGACCATTACTTAAGATCGGGATCACTGATATCTCCTCAGGATACGATATCGTCACCTTCTTGGATCGCGATCTCGCGCTCCTGTTTTT
CCCGCCGCAAACGTAACTTCTAACGTAGATTGCGGGTCCCACCAACGAATCAGGTAAAAAGGTGTTTCTCCTCGAATCTGATCTTGAATCGTGTTAATCG
CAAAAGTGAGGCGCTCTGCGTACTCATCCAGCCCTGACGTCAGCGACGTACATCTTTAGTGAACGGGTCATTTTTTGCACCATATGCTCTGTCGTTCCGC
TTTCCTATATTCTATATTCCGTCTATCTCGTTGTCTCTGACCCACGATCGGTTGAACAAACGAAAGATATCGGACATGAATCCTGGTTTTCGATCATGTC
TGATAGTTTCATTCACTTCGAAATGGAGGAACACACATTTTCCATAGTTTCCGTCAACCGTCTGCGCCGTCCGGGATATGCCAGCCTTCGCTATAATATA
CCCTGAGAAGGTATCGATACAAATGAGTTTGCGTCGTATTACCCTTGAATGAATCAGGCAGCAACGGAATGTGGTCCCTAGCAACGACCTGGAAAGGATA
GTTTGTAGAATACTGGGAGACTTTCCTTGGATCGTCGGACCCATTTCCTGTGTCACACTCCAAACATTCGCCCACATAGCGTTGTACGCTCCAATATAAT
TCTCTCCAGTGGAATCGAGATTTGATCCGCTGGTAAGTCCTGCCTATCCCTAGATGGCCTCCTTCCAGACTGGCGTGGTAATGATGTAAGAATTCTCTTG
TTGTAACGTCTCAGGTATTACCAGGTGCAACAACCCATCGCGATCCTCTGATTCCTTTTTCGCGATCGGACAGAAAAACAGCAGATTGCTCTCATCGATC
TCATAATCTCGCGCGATCTTGGTG