Description :
From Genome Similarity Track
Location :
Scaffold_8:1243- 3042
Transcript NameFunction/comments

Sequence
1799 bases(100 bases per row)
CATCGCTGGAATTCGGCCAGCGAGCACAAATAGAAGGTAGAAGCCGCGAAATCAGTACGTTACGGTAAGCTTCGCTTAGTGATTTCCTTCGTTTCTAGTG
TTCCTGCTGGACGTCGTTTTCTTGAGCGCTGAGCCGGGACATTTTTGACAAAAGAACACAAACCAAGCTTTCCGTCAAAATACTGCTGGGTATTGACTTC
GCCCCGAGGTCTCGCAATCGCACCAAGAACCAACACTCGCGTGATAAACCTTCTACTCTTGACGCGTCGTGTGGGGGCGTTCTCACCGGGAAGGATCAAG
AAGCGGCGGGTAGTTTCGGTGACGTAGAATAGCTTCTTGTCAACATGCACAGTGTCCAGCATATCGGCGAAGAGATGCGTGTCCATGTTGATATGGCTCA
CGCAGAAGGGCAGTCGGGCGTGGCGGTTTGCCTCAGTTAGCAGCGGCTTCACGACGCTTGTCACCTTGCGCAGATCGCCTCCTTTAATTCGTCGATGGAG
GGTAGTCTGTAGCACTCCACAGGCAACAGCAGCGGATCGCACCGTACTGCGTGCAGCAAAATCTATCTGCCTCAGCTTCCCTAGCTCTTCACTTCGGTCC
TCGGCTTGGCGGCCGCTAATATGCATGCGCGACAGGGCAACGTAGAGCCCCGTGAGCTCCGCCTCTTCCTTCGCTCGCTGACACAGGCGAGACGCAGTGC
TTGGTTGGATGTCATAGCGCAGAGCAATCGCACTGAGGGCGCCCCGCGATAGTTCGCCTTCGGGTCCTGCCATCCGAAGAAGGTCGACAGCAATGCGCTG
GCGATCCATGGATGTAACGTTGCTTGTGTGGCGGGCGCGCTTCGACGGCTGAAGTAAGTTGGAAATTGGGGTCATGGTATTCGTGCGTTGTTGCTTGGGG
TAGGCGAAATTTAGAATGAAACTTAGCTGAATCCCCTCTCGCTCCGGTGGATGAAGGCTCTCCGCCACTCAAATTGATCGTTTGCCACCAGCACAAGTCA
ACTGGCGAGGGCCCACACACCATTCAAACCGCAAGAACTTGGCGCGTCGTTCCACACCGGTAAAGTGCACCGGTATACTAGTATTTACCGATTGAGCTTA
AATTTTTTTTTGCGATTGATCTGGAACGGAGTGGTATATATGCAATTACACGAATACATTTGCGGCTGCACACGCCAGCAGTTGTGCCACACGCTTCAGC
GAAGACGCTTAGCAGGATACGCAACCAGCCCAATTGCTAATTGACTCAGCCCGGGATTAAACCGGGTCCCCCGGACCGAAGCCCGTCGCTCGATCATGAG
CTTCTGAGTCAGAGAGGGGGGGGGGTCTGGAGGTTTGCGCGGTAGCGTTGAGAAAGAAGGAGCGCTGAGGGGGACTCACTGTCGGTATCGCTGCTTGTGA
GTGTGACAATAACTACCTTGCCGCTTGTTTAATCAGTTGATTAGACGTGCAGCATGAGTGTTATTGGCCGATATTCCACCAATTAAATGAGGCAGACGTA
ATCCGCTGGTTGATGGTTTTAATAGAGGACCCCGCCACGAAAATCAAAGGCTCATTTTAGATTTGACAGGCTCTCGAGCCATGTGCTCTCGAGCCAAAAT
TGCATGAGTTTAGTTTTTATCATTTTTCTCAGCCCACTGGGCGTTACAGGCAATTTCCTTGCGCCTATAGAGGCGCCTATATAAGTGAGTTAGACTGCCC
CCCCCCCCCCCCCTAAGGGCCGTTCCGAACCGAGGTCGGATCGGATCTCGGGTCGTGCGGATTAGGGGTACCCTCTCAGGCCGCGACCCACCCGTTCCA