Description :
From Genome Similarity Track
Location :
Scaffold_14:124299- 125349
Transcript NameFunction/comments
Phyci_90913Hypothetical protein

Sequence
1050 bases(100 bases per row)
TTGCGCTGCTGTTGCTGCAGCATCACCTGCTCCTGCTGAGCCTGCAGCTCCTCGAGCTTGCTTGTCGCGCGGTACAGCGGGTTGATGATCTGGACGACGT
ACTTCTGCGCGAACTCAGCATCGTGGCCGTGAAGCAGAGCGGCAAACAGCTTGAACACCACGGCCTGGACTACGGTGCTGCAGTTCGAGCCGCGCGCAAC
ATACGAGAGGCGCGTAAGCAGCCAGCCCATAGGAGTGCGCGACTTGGCACGTtcctcctccttctcttgctcctcgcggtgctgcagctcagcttcatcc
tccttctcgtcagtctgctcctgctctgcgtcttcttcttcagcagccgccgccgcagcagcagcgtcctccaacaagtcaccacccaccacagcagcag
cagcagcagcCGTCACATCTTGCGGGATATCCGAGTTCTCGAGCGCCTCGCACAGGAACGGGAGGGCGGTGAGCACTTCGCTAGCCAGCTCTTCGTTCAG
AGCTGGTGCTTCCAGCAGCTTGCAGAACGCGCTTGCCCAGCTGAACAACCGGCCAGGACGCTGGAGGTACAGCGCACCATTGCGCAGGCGGTCGAGGATA
TCGCCTGGAAGACGCTTCACCGGAGCTGCAAAAGCAAGCGTGTTGGCTTGTCGACGGCGCAGATACGACGTCAACAAGCGGGTCGCGCCAAGACGCACCC
ACGCGTGAGGGTACTGCAGCAGCGGCAACACGACAACGTCGACAAAGTTCTTCGTCGGCTTGGACTCCTCCAGCCACATCTCGTACGGTCCAGCAAGGTG
ATCGCTGAAAGCGGTGAGTGCCACGCAGACATGGTACGTCGGCTGCCACCGCACCTGGCTGTTGTCCTCCACGATCTGGAGCTCGCGCAGACTGCGCTCA
AGTGCCGTGCGCGTCGCGGCAAGAACCTGAGGAGCACTGCGCTCGAAGAACTCGGGACGGGTCTCCAGTACCAGCGTTGTCACCTGCGCAGCAGCTCCCA
GAAGCTTCACTGCATCTGCCGCCTCGGAACTCGCAGCTTGCGTCCACCAC