Description :
From Genome Similarity Track
Location :
Scaffold_4:124257- 134809
Transcript NameFunction/comments
Phyke_g428hypothetical protein PHYSODRAFT_552366
Phyke_g429hypothetical protein PHYSODRAFT_349212
Phyke_g430conserved hypothetical protein
Phyke_g431hypothetical protein PHYSODRAFT_466642
Phyke_g432hypothetical protein PHYSODRAFT_468503
Phyke_g433conserved hypothetical protein

Sequence
10552 bases(100 bases per row)
TGTGGAGGTATGTTTTGACGTGGTTGGTGTGCTATTGGTATGAAAACTAGGTGGCCAAGACCAAGGACATGAAGAATCTGCTATGCAGTCGTGGTTGGGA
CCATGCGCTGTTCATTGGTGGTGAGGAggttgaaggcaacttccTACTGGCGACCGGCAATATCCCGTACGTGGACGCGATCCCGCAGAACAAGATCAAC
GTCTACTCGATCTTGCAGAAGGATCTATTGGTCATCACCAAGGATGCTGCCAAGTACCTAGAGGAACGTCTGCACGTTGACTAAGTAGAAACACACAGTC
AATGGGCTGCAAGTACAGGATAAGAGGCGAGAACGGAGGGAGGGGACAACTCAACAGATAGAGCGTGACTCAATTGGGAGGGACCGGAATGCACTCGTGT
ATCACCCTATTTCCTACTTCCACGATGATAATAATGCGTCCTTTATGTCTAAATAGACGGCACGTCGCTGAGATCTACTGTCGGCGAGAGCTCCGGGTGT
TTGACACTCGCCCGCAGTCTTTCTTCCACAGGCGCCGGCTCACTGATTTCAATCGCAGCCGAGTCGCCGGCATTGATCAGATGTGCCTGGCCTAGAAACT
CTTTCACAGCTGTCAGCTCCACAGTTAGTGCTTCTCTCTGCTTGGCCATGgctgcctccagctcgtctCTTTTGGCCTTGAAGTTGCGGCCATTGGCCAT
GACTTTACTCAATGTCTCCTTGATGAGGCGGCTCTCGTGCTTGATGATCGCCAAGTCGTTGGCGCTGGCACCCGAACTGGAGTCAAACTCGCCCATAGCC
ATACGCTCCAAATGCCAGTCGTTTAAATTGCTCACTCGCGCATCAGGGGCACTCAGATCCAGGATCTCTCGGAAATCATCGACGTTACGGCGTTGCTGTA
TAGTAAATGTGTCAATATGCTGACTTTAGGGACAGTTTTCACTAGTATCTGAGCAATTTAGAACAAAATAACTTACATCGTAGACGTCCGCGAGCTCCTT
CCACTTGCCCTCCAGGTCGTTGCGAGTGTACAAGTCGCAGATGGTGGTCACAACGGAggtgccagcagcagcgtcttccttGCTTCGAGGAAGCATTTTC
GATGATACTCGATGAAATGGGTGATACCGGTATTGAAACTGGTAATATCGGTTACATCTGAGATTGCATCTGAGACCAAATGCCTGTGATCTGAGACCAA
TTATTGGCCATCAACGCTGCCAGCTGAAGCCATGCGCTGCCACtacgaggtgctggatgtggcGCGGGACGCGACATCcgtggagatcaagaaggccTTT
CGTCTGCAGGCGTTGCGCTGGCATCCGGACAAGCACCAGAAGAACGGCATCTCCAATGAAGAAGCGACGGACATGTTCCAGACCATCCAGAACGCCTACG
AAGTTCTGAGCGACCCACATGAAAAGAAATGGTACGATGAACATCGAGAGCAGATTCTGCGAGGCGGAGACGACggtgacgaagatgcaaGCGAAGATGA
ACTCAATTTGTTCCGGTACTTCAGTTCATCCGTCTACAAAGGCTTCGGGACGGACGACAAAAGCTTCTACGTCGTGTATGGCGAGCTCTTTGCTAAGGTT
TGCATCAGTATGCTAACTGTATAGCTTTTTTCGCTGCAATTCTAATGTGTAAATTTGCATATGGTGGCTTGTAGATTGATGAGCTGGACTTGGAGAATGG
TGATGCGTCCAGAACTGATGCTGCGCCGGTGCTTGGAGACGGTCAGACCTCGATGGACGATGTGAACTATTTCTATCAGCACTGGAAGAGCTACATAACG
CAGCGCAGCTTTGCGTGGGTTGATGAGTATAAGACCACGGATGCACCGACACGACTGGTGAGACgcgcgatggagaaggagaataAGAAGCTGCGCGACA
CTGCGCGCAAGGCCTTCACTACGGAAGTGAGGGAATTAGTGGACTTTGTCTGTCGCCGTGATCCACGCATACAGTCTTTTCAGAAGCAaaaggagcagga
gaaggagcagaGACGcattgaagaggaggctAAGAAGCGCGAAAAGCAGGCAGCTTATGACGCTGAACGACGTGCTTTccaaaagcagcaagaggagcgC
TGGGctgacagcagcatgcaAACGAGCCGTGTGACCGATAGAGATATCGAATTGGAGCTAGAAAAACTCCGAAAGAAGATGGATGCAGACGTACTTGTTT
GTGACTTGTGCAACAAGACGTTCAAGTCTAcgaagcagctgcagaacCACTTGACGTCAAAAAAGCACCgggagaaggaggaggagctcgGCGTGTTCAG
TGACATGAGTATTTTGGATGACGAAATGGACAGAGAGCTTCGAGAAGAGCTCATTGCACTTGGCAAGGTGAAATGCGACGCTCCTGAACTTGAAGATAAC
TCTATCGAGCAGTCTGCTGATGGGCAAGCCGTCGCACcagaagaggacgaggaacagcagaaagctgacgaggaagctgagctCAAGAAAGCTGAGGCGG
AGTGTGTGAGGCTTGAAAAGGAACAGAAGGCCGCCGAGAAGCGCCGGGAACGAAAAGAGATGCgaaagaacaagaaaaaGGAGAATGTTGAGAAGATCGT
GTCCGGTGCAAAgtcgaagaaggagaaagaggaCCAAATGGAAGAGCAGCGTGGTCGAGGCAAGAAGGGCGgaaagaagagaaggtgATAGAGCAAGCGG
TAATAGAGAAGCAGATCCCGCACATGGCATTAGTTTGAATTCGAATTTGTAGTTAGGACTGGTTCCTTAAAGCTGTGGCGCAGGCTTCGCAAACGGGCAT
CCACTTGGATGCAGAACACTTGGTTACTGCTGGCTGCGTACTGCAGTTCGAACAGTAAATCACGGAATCCTCTGGGTCGGCAGCAGTTTTCGCCGATGCC
AGGGGATTATTCTGCTCCTCGGTGGACGGTTTGTCGTGGGCGCGCATTTGGCCTATTTCACGTTCTTCTCTCCAACGTGAGACCCGAGCGCGCTGTTCCT
CACGCCGTTGTTGATCAAGTATCTTCTTTAATGCTAGATCATTCTGCACCCGCTCGTGAAGAGCATCAAACTGGTGGTGAACCTGATCGAAGAGCCATGT
AAGCCCCATTTCCAGGCGATCGTCTACAGCTCCGTCATTAACAGCAGGCTTGGAGACACAGGGAACGAGTTTCGAGCTGGGGTATttttgcagacgaaga
aaaTTTTGCATCTCTTGCTCAGGAACTGCATCACAATGATCACGCTTGTTGGCAAAGCTGCATTGAGCACACAACACCTTCGGCAATCAGTTATAGCATT
AATACTACAGCCGAAGTTTGAACGTACATTAACAAAGGTTTGTTCGCCATGAGCTCGTTTGCCATTGACTCTTCCAGAACAGAAGCGGCCTGAATCACGG
AGTTCTCGCTAGATGAATCGACCACAAAAATGACTCCATGGGCCTGGGTAAGTAGCAACGATGGTTTGTCAATACCGGCAAAATATATCTTGTGCAATAA
ACAACCTGTCACTTACGTCGGCGTAGTATTCCCTCCAGACATTGCGGAATGTTGGGCCACCTCCGAGGTCATAGAATGTTGCAGACCCTGTTTCAGTCTC
GAACGTGGCGGATGTAAAACCTGCACTCGGCACATGTTCCTTGTCTAAGTCTCCCTGCAAAGTGGAGAGAAGTGTAGTTTTTCCTGCTCCGTCAATACCA
ATGATAAGAAGTACGATCGCCATCGTGCGAACTACTTTCGGGTTCTCCTGGTTGTTTTCAGGTTCTTCGTTCCTTGCCTCCTGCACTTTTGTCTTTCCAT
TTTCAGCATACTTTGGATGCCGCTTCAAGCACATGTAGTGTACATGGCTTTCGGTCTTTCCATCATCATACAGGATTGTGAATGATCCATTATCGTCTAT
AGCTGTGATTACACCAGGAAAATATCTTGGTCGGCCCTTGTACCGACACAAAACGTGGTCATTCACACAAAAGTGAACctttgcttcaacttggtttGAC
GGCTCTTCAGGGTCATCACTGGACGTGACAACGATGTGTGCAGCAACCACATCTCGGATGAACACTAACCGTAGTCAGTCAGTAAAAAAAGAGGTAGGAT
TAGTATTTGTATACAAGATTGGAAGTCTTTTCCAAGTTTTACCTTTAACGGAACTGGGTTTTTCACGCAGAATCTGCTTAGCAAGGTCGTCCATGACTGG
GATCACACTGGTGGACATGAAGTCCGCCATGTTACGGCGGTTAGCAAGCTTCTTGGCATACCCGACATTCTGTGGACGGTATGTGAAGCGCGAGGCCTTT
TGCTCGTCCACAAAGTCGTGGATAAAGTGGTAGACGCTCTCAGGCTGgtacaacagcagcgattcAATCAGAGGCATCAGGACGGGGTCCACACAACGTC
GCAGGTAGTCGTGCTCGTCCTCAATAGGCTTTCGTGGTGTGTCTAGTGTGTCATCAACACTATCAGTTAGATGAGACCATTGCAACGCAGCAATTTGGGA
CCGAAGTTCGCACCGACAGCATTGCGAGGCGTTGTCTTGATTGCTTCACGAAGTCTCCTAGCACTCATTGCTGTTAATGTGCTGGTATGTTGTGTTCACC
ACTATTGGACTGCTTTGTTTGGTGTCAAGTTGCACTAGAATAGTGAAGCCATGTGCTGACGTACTTCTAATTTCGAATTGACCAATCACTGCAGTTGTTT
CCACAAATAGAACCAAAACTTGAAGCCTGTCAAAAATGAAACCGACCAAAATGACTATGGTACTAGCAGCTCCCAGCAATGGGCTGGCGAGAGATTCATG
CTACCCGTTGTCTGCATGTCGAGTCACAACTAACGTACTGTACCAGTACTATTGGAAAAGACAAATCAGCGAAATGCTTAAGCGGACGCGATTACTCGAC
ACTTTCATCACACAAGCTTGCAAATGATAGGACAGTTGGAAATGCCACAGCGCCTGCCTCTATGAGCCGCACATTAGTTGCTCCAGATGTTGATCGTGTA
TTCATGGCCCAAGGGATTAAGGACAGTCTGTTCGACCGTCTATACCGTATTCAACCACTACAAACCACATCCAAAGCAACACAGGCAGTAATATTGTCTT
GATAACTGCTGCAAAACTTGCAACGGGCTAACATACAATTTACTCTTGACACTTTCCTCCGATGTCGAGCAAATGATCCTATCGCCAGAGACAGGGACAA
CGATTGCAGATTTGAGTTTCAACCGCACGAAACGCATCGGTTCTGCTCGGTCTAATCACGACGACGGACTTGCAACCGAGCAACGGGGAGCTGCAAAGCG
GCGTGCGTTGGTTCGTGTTTCCCTGCTAGCAGCAGGCAGGTGGTATACCAAATCTGTAACGGTTTGTGAAACGGCctttctaccaatcataTACGCGTCC
TTTGGTCCATGCTGGACTGGCTTTGGGACCTTTCTATGCACAAGCGACGCAGTGGGACATTTTGCTTGTGGACCGACACATACAAGTGCCGCGCCACAAA
GCTCGACTGTATTGTGGGGGACACGTGCATTTGCCTTGACCTCTTCCCTCGTAGCGAGGACTTTGAATTCACCAAGAAATCCATCGGTAGGAGGCCAGAT
AATGTACCTATCTTTGCAGGAATTTCCCCACTTAACGCACTCTGTTGTATGTAAAGCAGGTCTTCAAAGGTGTCAGAGCCTTATTACTCTATCACTGGCA
ATTGGCGACGCGTTTAAGCGCAGGATACAATGAAAGTCGCCGCTCTTGGcatcgtcgcagtcgctgctATGGCTGTTGTGGACGTGGCTGATGGGGTTTG
CACTCCTCCCAAGAAGAATACGCTGACTAGTGACTGCTACAACAAGTGCGGCTCCTCGTTGTGTGTGAACTACGCGTCGTCGAGCGCACAAGACCCGGCA
GAATCAAACTCAATAGGCAATTTTTTCTACCGTGGTTGTGCAGATGCCAACATCCCTTCGTGTCACACGAAAGTAACGTCTGGAGAGTGCGAGGTGCAGT
GCCTGCAGGGAGCAAATCCTAATGTACTGCAGTGGACGCTGACGATTGCCCAGCCCCAGGGTGATAAAGGGGATACTGCAGTCTTTCAAGTCGTTGACGA
TCTGAAGCTCCCGTCTACTCTACACAATTTGTACGATTTGAAGAGAGTAATGACTCGTATTGTGAACTTGCACTGATGTGTAGTTGCTTTTGGAATGCTT
AGGACGATCGTGGGTGCCACGCAAACCTCACAGATAACTGTACCGCTATCTTTCTCCTCGAATACGTTCACCAACGGCACGGCGCTGCAAGAAATGTGAG
AGAAGTGTTGTTCTTTTGCTGTGGAATTCTTGACACTGTACTGATGAATTGACCGTTGTTTTGGATGTTTTGCAGTACCATTACTGACGTTCAAATTGGT
GACATGATCAACAACATTTTTCCTGATACCCTCCTTTCACTGTACGTGCCTCTAACTCGAAGCAGCatgcaaaaaaaaacttacCTTTCTTGACTCATAT
TATTTTCTCTTTTTGGCAGGATTATAAATCGCGCACAACTTACACAGTTCGACCCACGTGGCACACACGGGTTTACATCCGTAACTACCTTGTACGTAGC
AACTTGTTTTTCTACTACTGCGCTTTGCTAACGTGTGTTTCTTATCTTACAGAGACCTCCGTGACAATCAACTGTCGGACATCCCCTCCATAATCTATGA
AATGCCACAGCTGTCAGCTTTGTATCTACATGGCAACGCCATCACAGACGCCCACGTTACACGCCCCCAACTCCAGTATTTACAGAGTCTGCCCGTGTTT
GAGGCTCATCTCACGGTTAATGGGAGTTGCTCTTCCGGGTACGAAGCATTTTCATGGGATGATAAGAGTGTGTGCTACACGAACGGCGACGGTCTCGGTA
TCATCAACGACTCTGGGTCCAATGAAAAGAGTACAACATCCACTGCTAGCGAGGACACTGGCGGTTCTGTGACTTTGTTCGTCGTTCTAGGCCTCTTACT
ATTCGCCGTCCTGGCAGTTGTTGGCGGGGTAGTACTCTTACGGCGGTGGAAGCGCAAGGCAGCAACACACCAGCATGATTCTGCGGTATCTGCTAATAAC
AAGATCAAGGCTAATCTGCGAAGCCTGCGCTCGAAGTTAACGGCTTCTAGCACCGTACAGGCTAATGATCTCGAGGCATCGTTGAACGAGTTTACTAGTG
GTGGTTTGCGCAAGGCTGCGTTTAAGGAGATTCCGGCTACTGATATGGTTTTGCTGAACAAGATATCGACTTCCGGACCCGTGAACGTCGTACTTGCAGA
ATATCGCACACAATTGGTGCTTGCAACGAATCTTGAGGTtagcgacgacgatgtggAGGCGGCACTGGAGATGGTGCCTACGCTTTCGCAGATGCGTCAC
CCTCAGTTGCTCTCCATTATGGGACTTGTCTGGGACGAACGGTACGCCATGACTGCAGTGTGCGAGTATATGACGTTGGGCACACTTGAGGCGTACTTGC
GGAGCTCAGGATCAGAGTTAAGCTGGAAGAACTTCAAgatgaaagcagcagctgaaatcGCGCGAGGATTGATGTACTTGCACAGTCAGCACATGGTTAC
GTACGACGGTCTCAATGGCAGGAGTGTATTCGTAGACCCAAGCAAAGGCTGCAAGCTTAACCCATTGCAGGCGGCACTCCCCACGGAAGGTTCATCGCCC
TACAGCAGTCAGACGTACATTCACCGCTGTGACTCGACAGCCAAGGCATTTTTTGCTCCTGAAATTCTCATTGGTGAGCCGTCTCGATCATCTTCGGACA
TGTATGCGTACGGTGTGCTGCTTGCTCACTTGGATACGTGCCAAACGGCCGATGAGATGATTaggagctcgtggagaaTGCGCACACAGATTGGAGACTT
TGACTCAAGTAATGGGACTCTTCTCTCAACTGATGGTACAATTGTGTCGACTGGTGCCGGTAGTGGTCTGGATGATTCACGGAGACGAACTTTCGAGATT
GGCGAGTTAAACTCACAGAGTTCGCGCAGTCTGGTTTCTGAAGCTTCGCGGCGGCGAACTACCCCTCAATTGAACGCTCACGCACaagacgacagcagca
caagcttcaTGAACATGTTCACGTTTACACCGGAGTGCCCCACAATGGTCAGAGAACTGGCAGGTGCGTGTCTTCAATACGATCCGTCATTGCGCCCCAG
TGCATCGTACATCGCAGCAATGCTGCACACCTAGGCAGTCTGCAAAGTTAACCAGCTAGTATACATAAAAAAATCAGTACAATAAACAGATAAGAAGTGC
TTGGTGGTCTACTTTAGTCTAATCTAGTGTAGTTACAGCAGAGTGAGAGAGCGGGACGTGGCGATATGTGCGAGAGGTATTGACTTTCACACCCATCTTT
CATGTAAATGACTCCGTGAATTGCCACTCTTAGAAATTCCACCCGCTTGTGATGTCGTCACCGAGAATTGAGATTCCTGCTACTGCACCTGCCACCTTTG
TTCACCCTCATGTCTCCTGTCAGTTATCCTCTAAGAAGAGCAAAACTGATTGTAGCGTTTGTCTcgaggaaatggagaaggaCTTGGCGACGCTGGGATG
TGGACACGTTTTTCATTATGTTTGCGTTCAACGGGCGTTGGCAAACCACCAAGCTTGCCCAGTGTGCCGACGTAAAACTATCGCAACGAGCGTCGTGCGG
CTATACTTTGCCTGCGGTAACTCCGCTAGCAGTGACTGCCATTCTCAACCACTAGATTCCTGCGGCGACGACACCATAGAACGTGGCTCACCTTGCTCCA
GTCCCGATAACTACACTGCAGCGGTAGCCCGTCTTTCAAAGCGATTACATGCGATGCGAGGTGAGCTTCGAGACGTCAATTCGATCCAGCGCATGACGTC
GAGCCGGTCTTTCCGGCTAGAGATGGATTTACACCATCataagcagcagctcgagcagACCCGGGACCAAATACAGCGTATCCAAGGTGACCTGGCTACT
GCGAGAGAGCAAGCGAGGAGTTGGAGACGGATCGGTATGGTACACTTCTTTGCTGTAAAAGTAGCCGTTCACTTGCTGGCTCTGTAGGTCCACCTCACTA
ACTGTTTTCTGTATCATATTCGGACCCCGACTAGCGACCAAGAGCTACTCTCAGTCAAGTCAAATAACCCAAGCCAATATCAATCTGCAAGCGCAGGTTA
TCACTGCTGTCGATAAGACGCGGAAGATTTGGGGGCGTCGAGAGCCTCGTTGCGCAAGCTGTAATGATGTGAAGGATATCGTTCTGGGGCTCTCCTCCAC
AAATGAAGGGACACCGCGGGCTTTTTGCTGTCCGCGCAATTGCCGCCACCGAAATGGGGAAGTTACAGTGCAGTCGCTGCCTCGATCGATGCGTCTTGAT
GAGTATACTCTTTGAAGATCCATCAACTTGGTGATCCGTGCTCGACACATGCCAAGAGAGGTGTTGACTGTCAAGTTGAGGTGATCAACCAAAGTTTACA
TTGAGTTTAGCCTGTATTAGATGGAGTACAATGTGCGTTAGGTACTTTGGAGTAAGTTACACGTAAGAAGGAAAGCTTTGACATAGTTACATGATGCGGT
GACCGAATTGTTTGTCCAGGCGATCATGAGCTGCAAAATCTCGCCTGTCTAGTCCCGCAGTGTACGGAGACTGTCATGTCAAGTTCGACCAGCTGGGAAC
TGCACATCAAGCAGGTCCAACCACCGAATGTACAAAGTGGATCGTGTCATAGGTCCAGTTAACACTTCGAATCATCATTTTGTACCGGTAGCATTAGGAC
ACCGATTTAGCTATGCCAAAAATGGGACCACGTCCTTTCCAAGCGTGAGTCACACGCGATCCTGGGCTGTTTATCGAAGCATCGAAATGGATACGGTACC
CACTTCACTCtgattttgattggtcaaaatagCGCTTTTCGGCTGCCATCCGCTCATTTCGACGTAACGTGCATAAACTATCTGAACAATGCGGAACATG
TTCTCTCAATTACACGTATGTAAGATCAAGAGTGATCGGTATTCTTTACAAAGTTCAATTTTCTTTCACAGTTTTGCAAAATACTATAGAAATTATGCAC
ACCCTGTCATTTCACTTGCTCTGAAGCGGTGCTGGCTTATTGGCGCCGCGTTTTAAGCCCGCCCCGCTTACGGTGCAATAACGGATCCTGTGCTTCGTTC
GCCGTGGCGTCCAGTGGTTCTGCCTGGGCGCTTTGCGACGCCAGAGGCGGAGCTCAAAGCAATCAACCGCATCCTTCCGCGTGGAGGCTTTTCTCTGGGC
CTCAGCCCGACACGAGTGACTTGTTCTTTTGGCTCTAGAGCCGTCATTGTTATTCAGTCTAGAGACTAGCAATCTCGCTGCTAGGACTCCCTCTGAGTGA
GATTACTACTAGTGTTACGCGGCTGTTCGTCTACAAAGAGCCACGCAAGGGCCCTATCTCAAGAGTGAAGGGAATTGTCCAGTGGATGATCCTTCCCTCA
TATTACTACTGAGTTGCTCCCCACTTCCCTGTATGGAGAACGACACTGCTGA