Description :
From Genome Similarity Track
Location :
Scaffold_14:1242554- 1246409
Sequence
3855 bases(100 bases per row)
AAGAGTTGAGTGTACACGCGGGAGGCAACATCCCCTAAATGGTTCACATCCTGGGCTTAGCTGTGTGAACAGCTCCGAACCGCGTTCCTCTCGGCGAACT
ACGAGTACCACCAGCGCTCGCGCTTCCTCTTGTGCAAACAAGGGAGGCGTGAGCTGCACGAGTACGTGCAAGAGATTCGGGAGCTCACGGCGTCCCTTGT
GGGAAACCCACCCGACGAACACATCAAGATGACTGTGTTCATGGAAGGCCTTCGAGTGGGCCCCGCGCGCACTCAGCTGTTCCGGGTGCAGCTAAACACC
CTTGAAGACGATTCAAGTGGCTCTTCAGGAAGAATACAGCCATCGCCAGACGCGTACGCCGGCCTCAGCATGGCCTAAGAGCTCTTTGTTGACTTCTGGC
CGAGTGAGCCCCAACGGACCAGTTCCCATGGAGCTCGGGTCCGTTGGGCAGCGCGACATCCGCTGCTTCGGCTGCGGGAAGATGGGCCACTTCAAGCGCA
ACTGTTCCGCGTAAAGACTTCGCAGACGGTCTTTCCCCAAGCCCGTCCTCAAGGGTCGCTTGCAGAAGCCAGGATCCCGGGGACAGGGGAACGCCGGGAA
CCAGTAGGGGCGGGGCGCCCTACTGGGGAAGAACTAAGTCTTCGTGAAGGGTGCGCGGGTGGCGCGTACCGCGGGGACTTAGCACCTGAGAGTCTTCGCA
CTCTCGGATCGGCGAAGAGCGTCGGCGGGCCGCTTGTAGTACACGGATGTGTACGGGGATACGATCATCCCTTTAGAATCTTGATTGATTCAGGGGCGTC
GAAGAATTTCGCACGCCGCCAGACAGTTGCTCGCAGTAGAAGAAAGTTGTCCGATGCCTTGAGAGAAAACAAGGACAATGGGACGGTGTCAGTACGACTG
GCCGACGGGAAAGTTGTCGCTGTCCCCAACGTCCAAGTGGATCTGGCCGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGCTCACTGTTCTTGACATGG
ATCCGTACAGTATGATCCTGGGCATACCCTGGATTGAGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCCATTGGTGCCAGCCGCCCTGCGAAGTC
CGACAGAGCATTGGTGAGTCATGTTCTCACCTCATTCAGGACCCGGGGCGCCCGCAAGGGTTGCTAGGGTACCAAAGCACCCAGCAGATGCTTGGGAGTC
GTCGACGTATACGACGACTCCGAGGATGCTTTGATGGTGGCAGCGCTTAGAGGAGGCGCTGGACAAGTGGGTAACATAGGTCCACAGGCGGGTAACTTAG
TTCCGCAGACAACTGCGGCTGTCATGAACACTGACAATAGCGTGTTCAAGGTGGGTAACAGAGTTCCACACACGGTCACCCAGACCTTAACTGAAGAGGA
AGGCGTCGGACACGCTTCCTGTGTGGGTAACATAGTGCCACACGCGGTCGCCCAGACCTTAACTGAGGAGGAAGGTGTCGAACACGCTTCCTGTGTGGGT
ACCACAGTACCACACGAGGCCACGAGGGCCTCGAATGTCGGCGCTCCGACATCCCTAGACGTGCGTAATAAAGCTCCACGTCACGGTCGACGACGACGTC
GCTTCAAGCGACTCGGAGTCCAGGGACCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGTTATCACATCTTGGAAGAAGAGACCGGTTTACCCGTCAAGG
CATCTGCCAAAGGTTGCAGAGATACTGAACCTCGAGGAAATGACGGTCGAGTCTTTCCTGGCCAGCCTCAAGGCTGTAGAGATTGCTGAGATGGTGCTCA
TGAGACCTGAGACCACTCGGGAGGAGCTGAACTCCTCCTCTGTCTTGGACGAGAGCATCCTGGAAGACCTAAACAAGCCGCGTCAGGCGCGCTTGGGTTC
TGAGATCCTTAAGAACCCCAAGGATGCGGTATATCCTTTGGTGACGGAGTATGCGGACGTGGTGAACAAACACGCACCGACACAGCTTCCACCGGATCGA
GGAGTACGGCATGAGATTGATCTCGTGCCTGGCACAAAGTATTGTGTCACGAGGCGATGGCCTCTCTCGCGCGAACAGTGCGAGGTCTTTGATGCATTCT
TCGCTGCGAAAGCGAAGGCAGGCATGGTGCGGGAGGTGAAGTCCCCGCACTCGACGCCAACTTTCTGCGTTCGGAAGCCGAACGGAAAGTGGCGTCTAGT
TCACGCTTATAACAAGCTGAACAACGCAACAGTGTCGGTCCAAACTTCAATCTCACAAAAGGATGTGTTGTTAAACAACATGGCCGGGAGCGTTCTGTGC
GCTGGATTTGGTGGACAGATACTACCAGATCCTGATGCGAGAGAGCGACGTCCCGCTCACCGCGGTGAGCACTCCAAGCGGCATGCTTTGGAGTGGATCG
TCATGCCGCAGGGCTTGTCTAACGCCCCGGCAACGCTCAATCGCCTGGTGACGCAGCTGTTCCGCCCATTACGTACCTTCGTACAGACGTACTTCGACTA
CATATTCGTCCATAGCCGTGCCGAAGGAGGCATGGAGGTGCATCTGGGGCACCTCCGTCGAGTGTTGAACGTGATGTGATCGAACAAGCTCTACGCCAAC
ATCGACAAGTGCTTTTTCGCGTCACCAGAGATTTAAGTTCTTGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACGCAGGCAAGGTCAAGGTCATAG
CAGCATGGCCGACGCCCCGATCCGAAAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCACAAGTACAGCGCAGGGTACGCGGGCCTCGCTAA
GCCCTTGTCGGGACTCCTTCAGAAGGACGTCGATTGGCGCTGGGAGCAAGAGCACCAGTATGCCTTTGACAGCATCAAGGCCAGTCTCCAAGAGGTCCCT
GTCCTGGCCCTGCCGGACGAGACGAAGCCATTTAGCGTCGTCTGCGATGCCTCCAATTACGCCATCGGGTGTGCATTGCTGCAGGCCGACACGGCTGGAC
ATGAACGAGTCATCTCAAAGCCGCCGAGCGGAGCTACCTTGTCCACGACAAGGAGCTCCTGGCAATAGAGTATGCCCTTGTGAAGTTTCGTGTTCACCTT
CTGGGCTCCCGGCCCTTCGTGATCTACACAGACCACGCATCCTTGAGTACGGCGACAAATTCGCCTCACCCCTTCTAAAGTGGGAGAGGTGAGGCGAATT
TGTCCTTCTTCGCGGAGTACAACTTCCGCGTCGAGTACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCTGACTACGCGTTGGC
CCACATCACACGGGTGACAACGGATCTATATGATCGGATACGGATGACGTATCGGGACGAAGAGGCTGTCGCGCCTATCGTCAAGTTCCTCACGGCAGGA
ATGAGCGCGAAGTCCGACTGCCTTTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAAGATGACATCTCTATTACCGGGTGAAGCCTCTATT
ACCGGGTGGAGCCCAATGAACCTCCACGGGTGGTCGTACCCAACGACGAGGATCTGAAGTTCGATATCCTCGCGGAGGCGCACGACGCACCCTCCAGCGG
CCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGGCCTTCTGGTGGACACACATGTACAAGAGGGTCGCCCGATACGTGAAGACATGCGAAACA
TGTCAGCGGGTCAAACTCGCAAGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGACTGTTGGAAGTTGACTTCATCTTTGGGCTTCCCGC
CGACGGGACGGTAACACCGGAATTTTGGTGTTCGTGCGTCGGCTCGGAAAGCCGG