Description :
From Genome Similarity Track
Location :
contig_5:124226- 127618
Transcript NameFunction/comments
g1515.t1RAW37271.1 hypothetical protein PC110_g6455 [Phytophthora cactorum
g1516.t1POM58478.1 Pyruvate dehydrogenase [Phytophthora palmivora var. palmivora

Sequence
3392 bases(100 bases per row)
ATGAAGCGACGGAGCAGTTCGGTGCGAGACGATGGCGGCGCGGAGCAAGAGCGGGGCGCGCACCTTCAACTCGCACAGCGCCACCGCAAGATCGTCGCCG
GGAGCTTCAAGGGCCACTCCGCGCTGGAGCCCGAGTTCGCCACGCCCGGCGTGGTCGGCAAGTTCGCGCTGCGCTTTACGACCACCGGACCGCTGGCGAA
GCACGCACGAATCACCTGCCAATTGCCGGACCACGGCTGGACGCTACCCACTGCGTCGCCGCCGACTGTCGTGCTGCAACTGCCGTCCCCCGAATGAGCA
GGCGACTACCGCCGCGCTGCCGCTGGTGAAGATGAACTGGAGTGCTGCGACTAGAACGATGGAGTTTACGCTGCTGAACGAGAGCGTGATCCCCGCGGAC
ACGCCCTTGGTTCTGGTGGTGTCGGGCGTGGGGACCCCGGAGAAGGCGACGCCGCAGAGCGAAGCTGTCGTCACGACCTTCGAGAAACTCGTGGCGAGAA
GCACCGTGCCGGCTTCCACACGCGGTGGACAGATCATTGATGGGCCTGCTGCCTTTGCAATTCCGAAAATCGTGCCGGGGTCGATTGGTGGGGCGAAGCG
CTGGAGCCCGTCCAATTGCTGTCCGGGGGTAGTCTCCGACGTGACGCTGGCGTTTACTGTCAATGGCAAGGTTCCTGCGGGCGGGAAGCTGCTCGTGGAG
CTGCCACCTGACGGCTGGGATATGGACGGCCAGCCCAAGGTGCTGCTTCGTACGCCAGTGTATCACAACAAGGTCCTCACCGCTTCCTGGGATTGCAATC
AGCACACCCTAGAGATTTACCTAGGCAATGATGGGGCGTCTATTGCTACCAAGACAAATGTGATCCTGACGGTCGCACAGGTGAAGAATCCAAAGAAAGA
GACAATGATTTTGTCCGTGTCAAGTGCATCGAGTGAGACGCGAGCTGCTGCTCGACTTACCACGCTGTCAGCGAGTGGTGGCGTGATTGATGGCCCCAAC
AAAGTGGACGTGGCGCGAATTAGTGAGCTCCGAGAACGGGACTTTGAGGTCCTCACAAAAGTGCTTGACGCCGATGCAGCAGAAAACACTGAGGATGGCA
TTTCCATTGCCAGAGTTCCAGCTGTCTTGCGCCGAGCAGGTTTGACGCTCTCGGACGAGCTGTTTCAGTCGCTTGTGGCTCCTTGTTTTCCAGTGCGAGA
GGACCCTCCCAGAGGTGAATCGGAAAACAACGAAACGTCGCTGGTTAATACACCACTCGCTGCTACAGTAACACCGACCACACCGGCAGACGATTATCTC
TCCAGAGAAGAGTTACTCAATGTGTTCGCTCTGGTCTACGCCCCGGCGTACAAATACGGCCAGGAGCTCCGTCTAGCATGTGGTCGAGGACATGTGAATC
TCGTACGAGAGTGGATAAGTCGCGGCTGCAACCCAAATGCTGGGGACGCTTCAGGTTGGTCATCGTTGCACTACGCCGCCGACTTCGGCCAACTCGAGGT
GATCAATCTGCTCGTCGAGATGTCTACGCCACCTCCAGAGAACGAGTCCATTGGCGAAAACAAATTTTGCACGCTGGAGATCAATGCCCGCGATGGCCAC
GACTGGACCCCACTCATGTGTGCGGCAGCGAATGGCCACGTCGACGTCGTCCAGAGGCTGCTGGCGCTTGGCGCGAGCGTTACACAGACCAGTGCTGAGC
ACCGCTCGGCTCTGCACTGGGCAGCAAGTCGTGGATTGGCCGCAGTAGTCTCCGCTCTGCTTGCCGCTGGCGCAGACGTGCACCAAGCGGATCGATGCGG
CTGGACGCCCCTGCACTGCGCGACACTGCACGGCAACACGAGCTGTGCGGCGCTTCTCGTCGAGAAAGGCGCCGATTCGTCGGCTCGAGATAAACTCGAG
TACACACCCACTTTCTTCGGCGATGCCACCTTCCTCCTTGCGCCGGCAGGCCCGTAGCAGCAATAACTGTACCAAATCCACGCGACCTTTGTCTCGTCCG
AGTCCAAGCAACTGCAGCTTCAAGTCAATGCACTCGAGTTCGCCAGTGCAATCTAACTGTGACGCCCTCCACCTCCTGCAGCACCTGGTGGAGCGTAGGG
GACTCCTTGCATTTCTTGCATTTCTTGCATCCGAGGATATAGACAACTTTCGTACTTACTCGAAGACCGCCGTTGCGCAAGCACCAACTTGATCCACTAA
AGCCCAGGAGCTCCTCACGCTCATTTTCCCAGTCTCGGAGCCATGGCCACATCTGCAGGAGCCAAAGTGCTGGCTGAGGTGTACCGCCTGCACCACATCC
CGCTGCCGCCTATTACGCTGCAGGCGCTACTCAAGCGAGGGCCCCGTGCCAGCCCCGCCATCACTGCGTCGCTGCAGAACGATCCGCAGGCGCTGTCCAA
GTGGCGCGAGGTGAACGCGCCCGCCATCGTCACATCCGCGCAGCTGCTGCATCGCGAGGCACCCATCCGCATCGCGCGCCGCATCGTGGACCTCGAGAAC
CTGCCGGACGAGCTGCCAGGCGCGCAGCCCATCGTGTCTCTGCGCGAGCAGCTGCTCAACAGCTTCGAGCAGCTCACGAGCTGCCCGCTGCCGGCTAACC
TCGCGGGCGAGAGGGACTTCGTGGAGCTGCACCTCAAGATCCGCAAGGAGCACGCCACTATGCACGGCAACATCGCCGAGGCCGTACAGGCGCTCGAGTA
CGAGCCGCAGGGACTCAGCGAGTCGCTCGACAACTTTTACAACTCACGCATTGGCATCCGCATGCTCGTGGACCAGCACGTTGCCGCGCAGAGCCCGACG
CCGGGCTTCACGGGCATTGTCAGCGACGAGTGTTCGCCCGTGCAGATCGCGCAGGGCATTGTGCACAAGGTGCGGCCGCTGTGGCAGGAGAGCCTCCACG
GCGACCAACTGCCTGCAATCGTTGTGAATGGGGAGGTGGATGCTACCTACCGCTATATCCCGCAGCACATTGAGATCATCTTGACCGAGGTGTTCAAGAA
CGCGGTGATTAACAGTGTCGCTGCGACCAAGAGGACGGGAACCACCACCCCGCCGCCTGTCACGGTGCTGATTTCGGGTGGGCCGCACGGCGTGTGCGTC
AAGGTGTCGGACCTTGGCGGCGGCATGACTCGCAAGGAAGCCAATGCGTTGTCGAACTACTACCACACTGCGACGTCGCCGCCCTCGAGCGGATACGACC
CCGTTGCGGATGTGTTGGAGAGGCGTGCTAGCGGACTGGACTTCTCAGACTCGTTCGGTCTGCGCATTGCTCAGCTCTACGCCAAATACTTTGGCGGCGA
GTTGGCGATCATGCCTATGGAAGGTCACGGTGTGGACACGTATATTTACATGAACTGCCTCACCGGCGCCTCTGAGCTCAAGTAAGAAAAGT