Description :
From Genome Similarity Track
Location :
Scaffold_25:124206- 126196
Transcript NameFunction/comments
Albla_Nc14029140
Albla_Nc14029150hypothetical protein SS1G_13224

Sequence
1990 bases(100 bases per row)
CGTCGATGAAGGGCTTCGTCGAGTCAAGCTACGCGATGTCTATTATTCGGCGGATCTTCCATGGAATATACTGTCTTATGGAAAAACAGAAGAAAGAGGG
TATGACCTTCGCTATGATGGCACTACACGTGTAGGGATTGGACGAAGCGACGGATTCAAGATTTTCGATGTTGAAAAGGACACGAATTAAGTACTGGTGG
TACGTGTCGTCACTGACGATGTCGATGCCATGAAAATTGAGGAGTGCGTAGCTGCAGCACTGGTTGAAGCCACCAATTCGAGGATCCCAGATGCTCAACA
AGGCAGTTTAGTGGACTTCCACTTGCGATTTGGTCACCTGGCCTATGACACCATCGAGAGGATGGCGAATGACCCGTCCAGTGGGATACTTCTCACGGAT
AAGAAAAGGCCGGCGTGCTTAACGTGTGCGAAGGGTAAGCAGACCCGCAACCATCACTCTATTCAAGACACAGGAATGAATGCTCCTATCGACCGAGTGG
GTGGCGTTATCTGTAGCGATATCAAAGGACCGATAGTGCCGATCGACAGGTGTAGAAACAGGTACCTGATCAATTTTGTTGATCACATGTGCAACTACTG
CCGTGTGTTTCTGAGAAAACTAAGGATAAAGCGACCAAAGCGTTTGAAACCTTTCTTATTACCTTGAGAAGCGATTCAACTGCAAGGTTCACTGCCTCCG
AACTGATGGTGGAGGTGAGTATGAGGTCGTCGATCCATTTTGCAAGAAAACTGGTGTGCGGCGTCAGATATCGGAAGCGGGTAACCAAGCTTCAAACGAA
AAGCGGAGCGCATGCACCAAACTGTGATGAACATGGTGCGCTCCTTGATATTTGGGTCAGGGCTGCCTTTGAGCTTTTGGGAAGACGCTGCAGAATACGC
GTCTTATATAATCAACCGCAGCCCGACGCGAGGAAATGCGGGTCGTGCTTCGTCGCTTCAAGTAATGACTGGAGTCAGCCCAACGCTGACGGATATCGTA
ATTGTTGGATCACCATGCACCGCGATTCGGACACCAAAACGTAAGACTATTGACCGGCGTGGGGAAGAGAGACTCATAATTGGTAAGAGCGACGAAACTA
AAGGTTATCGGGTGCTGTTCACGAAGGACCGTCTGGCTCTCACGACGCAGCATGTCAAAAATATCAAGACCCTTAGCGAGGACGTGAATGCAAAACTCGT
TCGTCAGATTGATGAATATGATGGGGTTGATGCTAGGAAGAAGAAGAACATTCATCCCATCGACATAGCCGTCTATTCAACAGCTGAAACCTTTACGTCT
AGTGACACGCTACCAAAGTCAAGTGGCGATGTTGGACATAGGGAGGAGCCACGAGTGGGATCAGGAAAGATCAAGAAGCGCGGCAATCGCGGTGGACGGA
GAAGTAAAACGACTGAGGCTTTAGCAACCAAGACAAAAATGACCGTGAAGACGCGATTTAATTGGTCAAAAACCCCACCACGCGAGATTATTGGTGCGGT
TTATTGTGTGGATCCGAAGAACTGGAAAGAAGCCATGGAGAGCGACAATTTCGTGGAATGGGAGCGCGCTGCTGAATCGGAGATCGATTCGCTCGAAGCC
AATGACACGTGGGAAATGGTGTTACGCACTGATGAAATGCGTCCTCTCCACACAAACTGAGTGTTCAAGACAAAAACAGATTCTGACGGAAACGTCGACC
GCTACAAAGCACGCATGGTGGCATGCGGAAATGAACAGTCGTTTGGTAAAAACTATACACTAACGTTCGCCGCAGTTATGGACATGACAACTGGGAAGGT
TATCCTTGCACTATCTGAGAAATGGGGTGCACCGGCGCGTCATGCGGACGTGCCTAATGCATATGTCAAGAACTCCACTGAACCGGATCTGGACATTTAC
CTATATGTTCCACAAGGAATGAAAGTGAGTGAGAAGGAGCTACAGCGTTGTGGTTCTCAGCACAAAAATCAAGTCGTGCTTCGGCTTCAG