Description :
From Genome Similarity Track
Location :
Scaffold_47:12420- 21464
Transcript NameFunction/comments
Phyag_g1155hypothetical protein PHYSODRAFT_309959

Sequence
9044 bases(100 bases per row)
TCGAACTTACTCCGCACCAGGTCGAAGCACCTTCGTgggacgtgctgctgcagaggctgAGCCCTTGAGCACAGCgtgtttgcgcttgcgcATCTGCTTG
GTACGACGCTTTTGCTCGTTCTTCTGCATCCGTCGCTGGGCTGCGCGCTGCGGGTCGGACACAGCTTCTGtacgacgctgcagtttgcggGCGGCGCGAC
GTGCTGCCATCTTCCTCTGTACGAACGAGTACGCCTCCAAGAACGGCGTGGCTCCCAGTTTCTGCTCAAGAAGTTGTAGCACTTCTTGTGCCAGCAGTGC
ACTTTCAGGCGGCGTCACGGGCTCAGAAGCAGGTCCAGTTCTCCGGTTCTTGTTGCGGgtccgctgctgttgctgcaacaacacttgctcttgttgaGCC
TGGAGCTCTTCCAACTTGCTCGTAGCGCGATACAACGGGTTAATGATTTGCACAACGTACTTCTCGGCAAAagcagcgtcgtggctgTGAAGTAGAGCGG
CAAAGAGCTTGAACACGACAGCCTGCacctcgttgctgcagcttgagccaCGTGCAACATATGATAGACGAGTGAGCAACCAGCCCATGGGCGTGCGCGA
CTTGGCCcgttcttcctccttctcctgctcctcaCGACGCTGAATTtccgcttcgtcttcgttATCGTcagtcttctccttctcgtcttcagcaacggcg
tcatcttcattttCGTCGACTTCAGCGTCCACAATAGGCTCATCACTCTCGTCATTCGACATggcaccagcagccgcagtcgTCACATCCTGCGGAACGT
CCGTGGTCTCAAGTGCTTCACACAAGAATGGCATCGCAGTGAGCACTTCATTAGCCACGTCGTCGTTCAGTGCCGGCGCTTCCAACAGCTTGCAGAATCC
ACTAGCCCAAGTAAACAGACGGCCAGGACGCTGCAGGTATAGTGCTCCATTGCGCAGACGCTTAAGGTCATCGCCAGGAATACGCTTCACCGGAGCCGCG
TAAGCAAGCGTGCTGGCTTGGCGCCGACGCAAATACGACGTCAGCAACCGGGTAGCACCAAGGCGCACCCACGCGTGAGGATATTGCAGCAtcggcagca
ccaccacatccAAGAAGTTCTTCGTCGGCTTCGACTCCTCCAGCCACAGTTCATACGGACCCGCAAGATGGTTGCTGAAGGCGGTCAGCGCCACGCAGAC
GTGGTAAGTCGGCTGCCACCGCACTTGGTCACTGTCTTCCACGGTCTGAAGCTCGCGCTGACGACGTTCGAGTGCCTTGCGAGCTGCGAGGAGCACCTGG
GGTGCGCTACGCTCGAAGAATTCAGGTCGGGTCTCCAGCACTAGCGTTGTCACCTGCGCAGCAGTTCCCAACAGCTTGACggcgtcagcagcatccgaAT
TCGATGCTTGTGCCCACCAAGTACCCACGAGCAGAATGCtctcgttcagctccttgTTGCCAAGACGTCGCACCAGCGTGCAAAGCGCTGCCCGAGCCAG
GTCGCGACATTCTGAGGCTTCATCATTGGCTAGACGAAGCACAAGCGGTAGGAAGAAAAACTGGGAGCGAGCGTTCACCAGATCCTGCGGCAGTTTTGAC
AAAAGCGATCGCAGAGCTTCGAGTACTGCAGAGCGACCTGTAGCATGTCCATAGCTTAAGTTGTCCACCAGGAACTTGAGATGACGGGACAAACGCTTGT
TTCCAAGAGGATACTCGAGCAGGAAGGTCTGGTAGATCGTAGCACAGTTCAGACGCGCACCAGGGGCATCACTCTGAACCAGGAGCTCACCAACTCGCAA
CATCACGTCATAAACTTCGCTCACCACGAGACGGGAGTTCACGATAGCCTTCAGCAGAGCGAAAGTGGCATTCTGGTGGTCTTGTTCATCGAGGTCAGCA
CGCAGGAAACTCAGAAGCACACGCAGTTGTGGTTCCGAAAGACGAAGGGTTTCGCTCTTAGCGTCCTTGGAAGCACTGCCACTCTCTTGAGCAAGTTCCA
AtccttgctgctgtctgaGGAGTGCAGTCAGCGTGCGGTAGCATGTCTGCACCATTTCGTTTCGAGTAGCAGCTCCTgcctgctgcagaatcttGAATAG
ACGGTCGAGTAGCGGGGTGCGTGTCACTCGCAAGGCTGGAAGTTCTTCCTGTCGAGGAAGCAGTGAGCCCAGGCACTTCAGCGCGTTAATAACTGCGCGG
TCGTTCTTCGACTCACCAGCACAACGCATCAGCAAAGGAACCAGCGGATCAACAAGTTGAGCTGGCGCATTTGAGATCTTCTTGCCTTCCTCCTGGTCCT
TGGCACTACCGTTCTTGCGAAGGAACGAGAACACCAAGAAGACAGCAAAGTTCAGTAGCTCTCGAAGATGCGCCGTACTCTCGGCTAAAAGAGCAGCGAT
CTCCTCACGCTTTTGTTTCTTGGTTttgctttgctgttgctgccgcatTTTATCGAAACCAGTGACttgcttctgcatctcgacGCGAGCGGTATCTATG
GCCTTCACTCGTGTTGCAAGCAGCTTCGTGGCTGCCGCACTCTTCTCTGACACTAGCCACGAGGTTACCAgcgcagtgctgctgccacctgcTTCGTATT
GCTGCTTTTCCCTCTCAGTCGTTGGGCGCAGACTCTCGAGGCTTGAATTGAGAACGTTGTATGCGTACAGGAACATGTACGATGATTCCACCGACGGATT
CTTGGCAAGTCCAATTGCCACGCGCTTAAgcgcctcctgcagcgcaGCTGTGGCttgagcaccagcgtctgTGGACTGGAAACGCTTCACAAGCGCACTC
ACTACTTCGTGGATACTTGGGTTAGGTAGGAAAGGTAGAGACcttgccagcagctccaacgagTCCAAACTCCGCCCACCACTGGCGCgtgcctccttca
tcttggatTTTTGAGCTGATTTGCGTTCCacgcctcctgcagcagcctctgctGCCTCGCCTATAGTCGTCATACCCTGGAACAGCTCTGCTGCCAGAAT
TTCCATTAAGCTTGGCACACATGCATCAAGTGGGGAGGCAAATTCTACCTCGCGCTCAGCCTCCTGCTCTTTGTTTTGTGTGAGCAGCAATGACTGAGGC
TTGCGAAGAGGACTGGACTGTCCATCTACCTTCATAATCTCCGGCAGCTTTTCCAATAGTGCATGCACGGTAAACGACAGTACATGAACCATGTATCCAT
CGCGTAGTGTGTGGCGAAGTTCCTCCACAATCGGTAGTAGGAAGCTCGCACCAAGTTCCACAGCGATCCGAACAAGGGTAGTGCGGGCCGAAACGCGCAC
AGCCTCATCCTTACTCTTCAATAAGTTCGCGAActttagcagcagctttggcaGCTCGCGTTGGAAGGTTTCAGCTCGTAGTCGACGCAGTACCTTCACG
ACAGCCAACGCCAGAGGCACACGAACCGATACTGCTTCCTCAGAGCGCGAAGTCGactcgtcgtcattgtccCGCGACTTagagctcttcttcgacgcca
CTCCCTTGAATAAATATGAGTAAAGCATCGGAAGTACTTGTGTCTCCATGTTATCCTGGACCTTGGAtacgtcttcttcctcttcatcaccaGTCTCATC
GTCATTTTCGGCTGGTATGCTATCCGTTTGACCCTTGCTCTTAGACGACGATGTTTGCCACTGAGTAGCTGCACCAGGTGCCTCGAAGTGGAAGTGGTCA
ATAACAGCGCAAATGGACATGATAATAGCCCCTTCCATCTCAACGTGTCCATCGATCGACTTCAATAGCCTCCGAAGCAGTGACAAGTAGTGTGACCAGC
CTagaagcccagcagcacttcccacacacgctgcagcttcagcacgcAGAGACTCCTGGCTTTTTGCATGGGTTTCGTAGACGAAGTGCAGTACCAACGG
TAAGATGACACCATTCACCGTCGAGTTTGAAAACCACAACGGTTCGTCACTTTCATTGCCCTCAACTTGATCCTTCGCCTTGGCAGCCATGGTATCCATG
AGAGTGCTCAGACGTTGTAGCGCACGGCGTCTGCGATGGGCCTGGATGTGCGTAATATTGTAGAAAAAGTCGGCTTCGGGGTCTTCCTGGTTGCGCGCCA
ACGCCAAATCTGCCGGGACGAACGCAAACTGCTTGAACGCTTTGTGTTGATCCGCCAGCGAACCCAGCAATGTCACGAAGCCGCGGCGCGCATTCTCATC
CGTTGAACGCAGACTTGCGCGTACACAAGGCATCACTAGCGACTCCAGTGCGTTAAGTACTGGGGACTTTACAACATCCTTTTGCTCGCTCTTTTCCACA
GCAACCTCTGCGGCTAGTCCCAGGAAAGTCGTAAGCCCAGCCAGTGCGCCGCTGCGCACTGAAAACTCGGAGTCATGCATGCACTGCAGGCATTGTGCCA
CAAGAGGAGCGAGCAAATGAGTTTCATCCGTCAATCCTGCAAAGCGCGTAGAGTTCAAGCGGTTCAGCACAATAAGGCGGCGCTCGTAGTCTGTCTCTTC
AATACGCTTGGTGTCATACGCATTGAGCTCAACTAGCAGCTCTGCCACAGGGCGCAGCTCCTTAAGCGCAGGGTGGGCGCCTAACGCTGTAAACACGGCC
ACAAGTTTCAGGCGGGGGTCGCGATCAATGATGCAATTAGGGCCCGGAGCCAACAGCCGTGCAAGAGCGAGCACATGCTTCTTGGGTTTCGAGAGTTTGG
GGACCAAATTTGCTAGCACCTCCAACAGGTTTTCCTTGTCCTTGGGTGATGTCTGGTGGTTGCGCAGCAAAaacggcaacagcaactggAACAAGTCGTG
GGCAGCGATAGCAATGTCACCTTCGGAAGCGTCCAAGTGATTCGACAAACGGCAGAGGAATGTTAGTTCCTTCCGTGATGATCCAGCGTATCGGTCACTA
GCGTAACGTGCAGCCTTTGCCTGGAAACGCTGCACGAACTGCTCCAACACAAAAGGAATCTGAGGTACCAGCAACACCTTTTCGTCCTCCTTGTTATCAG
TCATGGACTCGTCGTGGTCTTGCTCAACCAATAATCGTTCATCTCCATCAAGCAGTGAGTCCATGAACTGGAGAATTGAGTCCAGGATCTCAGGCGAAAT
GCCACGAATCGATGCACTCGATGAAGTCAAGCCGGCAGACAAACAGGAGATCACGTTGAGAACCAGAGTCTCCGGAACCCACTGACGTGCTCTGTCCGCG
CGTCCCATCGCTACAAGCAGTTCCAAAAGTGCCGACGCCTTGCCTGCACCGACAACGGCATGAGGGAGATGCGTGACGGCTTCGTGCGATgtctccagca
ctgcaactACCCACGGTCGAAGTTGCACAAGGGTATCGAACTGCATAGGCATAGGACACAACAACATTAGCGTTTGGGATCAATGGATATGCCAAGACTG
AGCACCGTACCGTGTCGATCAACTCTGCAAGTCGGCGGTAAGTCAGCATGCgaatctgcttcttcatcgatgCGGAAGTGGCTAGTGTATCCGCAGTTGA
TGATGAATCACAAGCTTTCCGCTTCGAGCCCACCGTTGcgctctcctcctctgccCCTTcatcgttctcgtcgtcgtcagcagagTCACTGCCATCTTCG
CCCGAAACAATGCTAAGCTGAAGaatcgccaccaacacgtcaGCAATACGAGGAACGAAAGCGGCCAGTTTCACGCCGAGTTGGTTAATAAGGTCTTCCA
GCAGGTTCAAGAAACCCAAGATACGGGATGGTTGCACGTTGACCACAGCTGCCACGGGCTTCACTTCATCAGCGACGACCTGAGTAATACCCTCAGGGGC
TTCAATCGTCACATCAAACGCCCGCACCACCAATTCGACAAAACTTGCAAGTTCAGGTGCCTCCAACGCGGCCAAGTACGCTAGGATGGCAGAACGACGA
GCACCGACGGTGTCACCGTTGTTACGACCCTTCTTGCTAACACACTTTGAGTACAGAACTCGCAGCAGTACAGGTAGAAGCTCCGGGCGGTGCTCGCGTA
GCAcgacaccttctccatctccaacctTAAAACTCGCGAGTTCTTCGCGGAACGAAGCTGAGTCAGTCAAGCGATTCAATTGTGTCTTGTAGGACACAAT
AGCCTTGTTGCCGAAAGCGTAGAGGCACTGCAATGCAAGCTTAGAGACCACTTCGTCTGACTTCATCAGCAAGTCAAAGAAGAGTGCATGGAGCAATTGC
TGCGCATAAGCACCCTTCATATTGTggaaagcagcaaaaagctTCAGTTGATCCACAAACTTGCCCCGCACCTCCTTAGTGGTCAGGCCCTGGAACTCGA
CAGGTTTCCTCCAATCGACGTCAATGGTGTTGTTGGCGTCTTCGACCTTAGCTAGTGCCTgatcgatcttctccagacgcttggcatccagctcgtccgt
gTAAATCGCGGTATACTGGTCACGCAAAAATGTGAGAAAGAGCGGCACCATAAATTTCGTTTTGGCTTCCACCAGGTCAGCGAATTTTAAGAGGCCCTTC
CACAGAAGTGAATGGTGCATGGCAGCATCCGTAGCACTTGATGCATGCACCTTACCCTGTTCCAGTATGCACACCTGTTCGAATTCCTCGATAACACCGC
TTGTGCTAGTCGTCTTGCTAACGTGCTTGTCCTCGTGTCGAAGAGAAGCTAAAAGAAGCTCCGCGCTGACGCATGGCCAAAACTCATTGAAGTGCAAGCG
AACTGCAGTCTCCACCGCATCCGCAATATGCGGCCAAATGGTTGAGAACTTGACATGGTACAAACCCAGCAACTGGTTCAAGGCAACTTTTTTGTACAGC
TCCGGGACCTGCGGAGAGCGGCAAAGGATCTTGACTCGTGTCACCAAGCGCACCACCTCACGCTCAGTAGCCACAGAGATATCCTTGCATGCGAGCTCGA
GGTTGACGCAGATATCGGGGAGATCGCATGGCCCACTTAGAGAGCCACTGTCAGAATCAAGGAAATCCGAGCGCTTGAAtcgcgccagcagctgcagtgc
cacCAAGCGCAGTTTGTGCGCGGGTGATCGCAACGATGggagcagcaagttggcCACACCGGATAGCGCATCAACTGTCAGCACTGCATGTTGCTTTTTC
TCGGGAACCATGTCAATGAGCGTCAGCAGCGTTGACAAAGTCTTGAACGAAGAGCCCTTGCTGGATAGAGCCTGCTCAACATATTCCGTTGTCAATGTCG
AATCCTTGCTCTTGGTCTGATGCTTAGCagtctgctggagctgccacAGCTCAGCACGTAGAGTAGCAACTTGGGCAGCCGAAGAGGATGACTCGCTTTT
CAGGCACGTGTCGTACTTTGCGATAAGAGGAGTAGTGAAGTCAATCATTTTGGCATCTTTCAACCGCAGAAGCTCCAGGGACTTGCAGAACTTCCAGGCC
ACAGCCAAACTTTCGGTATTTGTTTTGCCTTCAGTctgcttgaagagcttcctACCAGCGTCGAACAAAACCTTTTCGGCGTCGGCATCAATTTcctcaa
acgaaagcagCCAGTACCGACTGTTATTCTGCGAGCGAACAATACACGCACTCTGGCCCTCGTTGATTTCTCCTGCATTGATTGCAACATAGTCACCAAG
CTGACACAACAACGCGCTGAATGCACCAATGTCTACCTTCACAAGCGTCTTCAGTGCGAATTCCATAGCGTTAGGGAGCAAAAACTCGATCACAAACCCC
ACGACAACGTGACTGTTGTGCAGTTCCTGGTCcacaaactccagcaacttctgaCGCCAATGCACCTGCTTATCCTCATCCGCTGCCACAGCAAAAATGG
CCTTCACTTGCGCAGAAACTACGTCATCTTCAGCAGGGAACAGCCGCCAAACCGCTTCAAATGTCTGCAGGAGTACATCTCGCAGGTCTGTGCTTTGGGA
GGTCAGCACCTTATTATCTGGAGACACCAGCGCTGCGCAAATCTTGTGAACGCTGGGCACACGCACCTCATAAGGATCACTCGCTCCAGTAACCAATTTG
CCCATTCGAGAAATCAAAAATCCAAGTAATACACGAAGTACACGGCTCAAATACACATTGTCCGCGTCTGTAGGAGCTTCGTTCTTCTCGTGGCGAATCT
TAGTCACCTTattcaccaccagcaccagacaCTCTAGCATCTCCCCGGAGTGGTCAGAATCTGTATGTCTCATCATTTGTCCGCACGTTTGGTACACGAT
CTCAAACACCGCCTCCTGTTGTTCCATCAGCTCCTGCGTATCTGTCTCCCCCTTAGGCCTGAACGACCCCAGtaaaaacagcagcacctcccTCATCCGC
GAGTGGAATCCATGATTCACATTCTTCACCAGTGCAAAGAACAACTTGGCCGATCCATCTCTCAAAATCTCGTTACTGCGTCCCGACCCCTTCACCAACG
CTGTCAAGTATGCACGCAAGTACTTCCTCATGGCCTTCGGCGACTCCAGTCGTCTCAGTAAAACTGCCAATGTCTGCGCTGCAAAATTGCGGACGAATTC
TCTCGGGTGCCCCAGTAACGGGAAGTAGCATTTGTGTACAGCGTCCATATCGGCCAGTAGCTGCACTCTCAAGTAGCTAAAGAGCATGGTAATTGTCTTG
AACACTTGGGTACTGAGCTCCGGGTCTTTGGTATCAATAACTTCCACCACTAACGGTAAAGTACCCGCAAAATGCGGATAAAACTCCTTGCCTAGCTCGC
GTGCCAAAGCCGTCACCAGTTTCAGCACGGGCACGAGTCTCTGTCTCTGCACGACGGGGTCTGCATTGTCGTCTCTggcttcttgcagctccttctgtAG
TCGCTTCACCACTTTCTTCAAGTGGTGCAAAAGTTGCGGAGTGGTGGTCACCAGAGGCTGCAGAGCGCggaacaggagctggaagctgtcgAGCGTTGTC
AACTCGGCTTGGAGACCTAATTCCTCTTTGAACGAGAGCTGCGACGCCTCGTCCACGGCGCCTGTGGTCTTGGCGTGCAGTGTGAGCTCATCCTGTAGGT
TGCTCACGCGCTCCTCGACCTTCTGGAAGCGGTggcggcgcttc