Description :
From Genome Similarity Track
Location :
Scaffold_3055:1242- 3401
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_3055-snap-gene-0.0Cleavage induced predicted protein

Sequence
2159 bases(100 bases per row)
AGTAGTTGAATTGAGACCGGGTGCTTCCGGCGCTCAGGATGGTCGAGACGGTGTAGGCCTTGAAGGAGCATGCGCACTTGTGGGTGGCCGATGGGAAAAA
GAAGACCGCGGGCTGCAAAAAAATGATTCACTCCGTGAAGGATGTTGGCAACTGTACGGCTCTTGATCGGAGGGAACCCGGGTCGGTAGACACAGTACAG
GATAAAATCGGACACTGCCGCTGCTTGAAAACTCTCTGAACGGCCGATCAACCAGGGATGCGTGCCTGTGGTCATGCACCAACGTTGCCACCGCTCGAAG
GCACGACGGTACTTGGCGTAGGTGGACTTGGCAACGGAGTGGTCGCGCAGATAGTCTGCCAGGCTGCCTCTATTGCCGCTGAAGACTGGGGGGCTTGGTC
CTGTGACCAACCAGCAGTCAAGTCAGTAAATTCAGCTAGTTTGGTGGCGGATACAGACGCTCGGGATCCGGCATCTGCGCGAACATTATCGGAACCAGCA
ATGTGCGACGACGAAAACCGGACTCGGTGTTGTACTTCGAGCCAAGCCAAAAGACGGATCACTGATTGCGCCAACGGATTTGGGGACGAAAGCCGTGACT
GCCACGAGACAGCCGACGTATTATCGATCCGGAATCGCACGTGGGTGAGACGGTTGGCCTCTGGCGAGCGCCAGCGTTTTGCCCAACATATGGCGGCAAA
GCCGCACGACAAGAGCTCACGTAGGTTGATGTCGAACGCGGAGGGCACTCCGGTCTTGAACGCCGCGATCATCTTACGTTCGTCAGGGGTGTATGTGTAC
CGAATGAATCGACGCGATGTTATATCCATCGCGCAGCACCCCGAGTCGGACGCGTCGACTTCAACGACAAAATCGGGTGCCGGACTCGCGTCGAAATGGT
CCATGGGGACGCCATTGAGGGTTGGATCACGTAGGGTGGCCCACCACCAGCGGAGATCTTCCCGCATATCGTTCGTGACCCCCAACTGACTGAACCTGTG
GAGTCGCCGTTCATGGACGCGTAACCGCTGTAAGAAAGCGCGAGCTGGCCGGAGACACGTGGCTACGTGGCGGAGCGAGCCCACAAGCGAGCGATACGAT
GACCAGCTTAGACGAGAGGAGTGGAACGCGGTCGATACGGCCGCCTGGGCCTTCGCGATCTTGGAGGCAGGCATTGATACGGTGTAGTCGGTAGTGTCAA
AAATAAGACCGAGAATCTTCAGCCGCTGGTGCCAACCTGTGAACTTGGCTTCATTGATTGCGTGGGAACCCAGGATGGTGGTCATCGCTCGCCGAAGGGA
ACTATCGACGAATTCGCTCTGGGTTGCATCGGACGCCGTGACGCAGACGTGGTCGTCGACCCAATGGTAACGAAAGTTCTGATCGACGAACGGAGTCGGC
ATCATATGGTGCACGTGAGAGATGGCACCACCAAAAACTTCATAGCAGCTTGGAGAACCTGTCCACCCGAAAGGGCAAAAGAGGTCGATGATGAGAAGCC
CTAGTTCCGGTATGATGCCTCCGAACAAATACACGGAGTGGCTGTGGATGCCAACGTGCCGGAAAGCCGATGCGACGTCGCCGGCCATCAAGATCGGTGA
GCTGCCCCGGCTGGCTGCGCGACGCCGCAGAATTTCTTGAACAACTGCAGCACACGGTTGGTACGTGAGCTCCACGAACTGGGCGCGTGACGTAAAATCG
TTGATCGACGACCCGTCTGGGAACGCCAGGTCCTGAATGGTGCGGCCCGTGGTAGATGGATCCGATCCGGCCTTCGCAACCACCCCGAACGGGCTGGTAA
TTATCTCAGGCCAAATTTCGAGAATGTCGATGTCCAAGATGAGAATGCGACCGGCGTCTTGCTCTGCTCGTAGATTCCGAAGTAGGACTGGCAGTCGGNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGACGCGGACGCAAGGTTGGCCGGGCGGTTCCGCTGCCTTGGAATAGGCCTCGTCAGCTCGACC
GACACCCCGTTGTTGGCGTAGTCCAGGAGCTTGTCGAGATGGGCGTACGAGGCACACGACTTGCGGATCAGCGACGGTACAATGTGCTTGTTCGGACGGT
AATCCTCTGCTGATTGGCAGCGCCATAGCTCAACAAAATCGGGCAGGCGTGGACGGACA