Description :
From Genome Similarity Track
Location :
Scaffold_4:1241731- 1248352
Transcript NameFunction/comments
Phyin_T30-4PITG_03269Putative uncharacterized protein
Phyin_T30-4PITG_03270Putative uncharacterized protein
Phyin_T30-4PITG_03271Putative uncharacterized protein
Phyin_T30-4PITG_03272Putative uncharacterized protein

Sequence
6621 bases(100 bases per row)
CAACGTTCGCCTGTTCGGAATTCTGTCGAGTCGAAGCAGAAAATCTTCACCCTACCGAAGCTATCGGAGCTGTTGATTGACCAAGAAACTCGTGCTGCCA
CTCCACACAAACCCTGGGACGAATCGCGTAAAATCCAAGTCCTCGTCGGAAGCAACTGTGTCGGACGTGTGAACGCTGCGTCTCGGAATCTCCCGCCATC
CATCCGCTCCCGCTTGCGAGCGTCTGCAAACGTGTCAGCACGACGAGAGCGGTTATACGACCTGCTTCGGCGAGATTATGAGAAGCTCAGCACGTAAACG
ACGCACCGACAAGCGGCGACTTGGAACACTTCGACAGAAGCTGAGAGGAGGTTGGTCATTGCATTGGAAAGAAGGCATCATCTGTCAGCCCTTCGAAGAT
ATTTACGTTGCTGTCCCCGTATAATGCTGAGTCTGGAGACATGCTCATGGACCCCACTCCACTCTGCTGTTGGAGCTGATTTTGTTGCTGGAAAGACTGA
GGCGTGGGCTGGAACTGCTGTGTCGGTAATGGCTGTGGCATCATATTTGGTGCTGCCCCATATCCAAAATTGTTGGGCATCATCGACGCTCCTTGTGCTC
CGAAGTTGACCGCGTTCATAGACCCCATCATCTGCTGTTGCTGCATGGGCATGTTTGACATCCCAGTCATGGGGAATCCCGTTGATCCGAAGCTTGCATC
GGGGCCGAACCCAAGTGGCGTCATAAACGGATCCACGGGAAAGTTGTTACTGCTACTATTGTTGTTGCCATTGACGTTGTTCGCTGATGTCGATGCTGAA
GACATGCCGTAATTGTTGTTGTCGTACATATTCCCAGAAGACGCCAAGTTCATGGGCATGGGCATGGGCATAAACTGCTGTTGTTGCGGATTCATCATGC
CGCCGCCCATCATGTAGTTTTGCTGGTTCATAAATGCAGCAGACGAGCTCGGGGGTCCACTCGTGGAGGTCATGTACGCGTTGGGCGTGAACGTCTGTAC
CCCGGAGCTCATCGCGTATCCTTGTGTCGACGTTGTGACACCAGAGACAGCCATCGAAGAGCTTGAAGTGAAGCTAGTCGACGTCTGCATGGGGTTCATC
TGGCCTGTTGGGAAGAACATACTCGAGCTTGTCGACGCGAAGCCAACTGTCGGCATCGGAGGCTCCGGGAACATCGTTGGAGGCGTCGGTGCCCCCATAT
TTGGCATCGCCATGGACGCTGAAGTGGACGAGGTCATGGCCATCGGATTACTGTTAGCCCTCATCGGTGGGGGTGCATAAACCTGCTGCGGAGCAGGCTT
CGGCTGTTGTGGAATCTGTGGGACTGCAGAGCTCGGAGCTGCCAGTGTTGGGTTCTGTGTCACTCCAGCTTGTCTTGCTGCTGCTGCATTGGGCGATATC
CGCCGCCCTCCACCCTTCTCGTCTTCGTGAGCGATCTGTTTATCTGCCAATGAGGCTAACAGCTCGAGCCTAGCACCAATTTGTTGACGAAAGATCAGAC
ACCTCCTCACCCACTCCTTGTGCTCTGCAGGGTTTGTCTTGGCAGCTACAGTACCAATTACAGCCATAATATGTTAGTTTCAAAATGATTCATATTACAT
CAAATGACGACAAAAGAGTATTCCGGGGCTCGTACGCTGCTGCTTATGGAGCGCATTCCAGCCTTTAAGCGCTGCCTCATTCTTCTCAAGCATAGCCTGT
ATCTCTCGCTGCGAGACGGAGCGTCCCGGGGCCAGTAGCGCCTGCGAAAGGCCACCACAGTTAGGAATACAGGCTAAAAAACAAAACGTTTTCGTTGACA
TTCCACAGTGGATATTCTGCTTTTTAAAACGCACCTGCGCCGCAGCGGCCGCGCGTTGCTGCAGTGGGTTAGCATGCTCCCTGTTGGACGCAAGAGACGC
ATGGAGAGCGTGAGAGGCTGACGCTGGATGGACGGTAGAGGCGGGCGGAGTCACGTACGGCGCCGAGGACGACGCCATGGCCGATAAAGGCGGCGGTGTG
GGTAGTCTAAATAGCGAAAAATAGCATGGAATTGAGGGTAAGAATTATCAATCAAAATGCAACTAATCAAATGATTTTACTTAAGTGAAAGCCAATGAGA
AGCGAAGCCTAGCCCTTTTGCTTTAGAAAAAGCACCTGGCGAAACACCATGGCGAATCTCCGCCCCACCTGTGTGTCTGCACCTGGCAAAGTACTGCTTG
TGGGAGGGTATGTGGTGCTGGATGAGCAGTATTCGGGGGTAGTTCTCTCCGGTACGGCAAGATTTTACTCCCAAGTGGAGACCAAGGTACAATTTCGACA
GGTGGAAAATGTGTCATTTTTTGTCGAGCTCTAACGTCATTTAGCAGATTCTGAATGACAAGGACGCAGTTTCTGCTTCTTCAAGTGAATGGCATCAGCT
ATTCCCATTGACATTGGAGAGTAAACAGTTCGACCAGCGAATTGACGGTTGGATCGAGGAAAATGACGCCAGACGATTCCGTTTTCAGCTCAGGTGACGA
GAAACAGAATCGTGGTGAATTGTGTGGAGATAATTGACTGTGGTTTGTTCCAAGGGAGACTTCACATCGCAACTCATACATTGAGGAGACAGTTCTATGT
GCGCTGAATGGCATTGCCGGATTGCAGGCGCTCAAAAGCAATGATACTTTTCAGCATCTAAAGGAGACGAATGCCGGTGTTCATGTTACGCTTCGCGGTG
ATAACGACTTCTACTCGCAAGTGCAGAGGGTAAGAAGGAGCTTATTGCTATTATAGCTGTAAGGTTTGGTGGTGATGACGCTGATTTGCTTGTTAGTTAC
AAGATGCCAAGTTACCACTGCGTCGTGCCCACTTGAAGACACTCGAGGCATTCCTCCCTCCCACCATGGAAGGTATGCATGGGCTTGATCTACCTACAGA
TGTGAAATATGTGAAAAAGATAGTCTAATCTTAGTGTTTAGAGCGTGGTGGCAAGCAGGTTGCTCTGAAGACTGGCATGGGAAGTTCCGCAGCGCTTGTG
ACGTCGCTCGTTGCAGCTCTCGTGGCATTCTTTGTGCCATCTATGAAGTTCGATGAGGAACAACAGGACCTCGAAGTTGTACACAACCTTGCCCAACTGA
GCCACTGCTACGTGCAGCGCAAGGTAATGTCATCCGGATCATATTTTAGCAACGATGGTCACGTAACAGGTTATTCCACTCCTTATCTTGACAGATAGGA
AGTGGCTTTGATGTCTCGGCGGCATGTTTCGGCTCGCAGCGGTATACGAGATTCCCGTCGTCCATTTTGAACGCATTCGCGTCTGAAGATGCGATGAAAC
CGGAAGAAATTGCCCAGTGCATTACTAACCGCACCTTGTGGAAAACTTCTAGCCGCGTGGTAAAATATTGCTGGATGTTGGTGCAGAGTTTTGGCCATTT
TAACTCACTTTGTTGCACTGCATTTTCTGGTTGGTAGAAACCCGTTCGACTGCCTTCAAGCTTCCACTTAATGATGGGAGACGTATCTTCTGGTTCGGCT
ACCGTATCAATGGTTCGACAAGTGTTGAAGTGGCAAAGGGAGCAACCTGAAGACGCAAAGCGAGTGATGGATGAAATTCACGGTCACAATTTGGAAGTCG
AGCGAGGCTTTGCTGAAATCTGCGAGCTGGAAGCCGCCTGCAACAATCCCATAGATTGGGAAGCCATGGCAACTCAAAGCCGCGAGCAGGTATACTGTAC
TCCTGTCAACCCGATGTTCCTTCATATGCTCACCCTGTGTGTGTAGTGGAGTGCTATTGATGCTAGGATTGGGGCCATTCTTTTGAGACTCAGTGAAGCC
TTCTCTCATTTTCGAGTCCTCATGCGGTAAGCATGTTTTACTCGTTGTCGAGTTTAATCTGATGACACTCGGACTCATTTCCTTTTCACTTTTTATCTTA
GCGAAATGGGAATTTCTGCCGGAGTCCCAATCGAGCCACCCCAGCAAACTGCCATTCTCGACGCAACGCTGGCGATCCCTGGTGTTTTACTCGCTGGAGT
CCCTGGAGGTACGCGCTCATGAAGCATTTGTATCGTCCAGTTGATTAACTTGTCGCTGATGCTTTTAGCGGGTGGGTACGACGCGATTTGTGTGGTGGTG
CTGCATGAGCGAGTTCTCAGCGCAGTTGAAGATTTGTGGGTCCAATGGCCTACAACTCATCCCGACTCCACGTACGTATTTCAGACTATTCGCTTGCGTT
TATTACTTCTGACCTGGTGTGGTTGTATTTGTTGCTATAACCCAGTATCTGCCCGTTGCTATGCGACATCGACCGTGGCTTAGCTGGGGCTTCGTCTGTA
AAGTCAGGGCTTCAACTCCACCCTGTTGAGTAGTTTATATCCGCTTAATGTGACATTGATGCATGGAGTTTCCTAGACTAATACTTGACTTTAGTGCAGA
TCGTCAGTAAATGTTTGTAAGGGAGCGCTAGATAAACGGAATCTAAGCTCCTGTCAGGGGCTGACTCCCAAGTCGAATATGTCGAAGCGCAAATTCCTTG
CCGATGACGATACTGAGGGGAATACGCACGTAAAGGTGTCGCGTGACACCAAACAGGCTGGTCGAGTAAAACCTTCGGAGCAAGTACAGAATGGACATTA
CTCCATTCCTGGACTCCGGTATGCGACCGAGTCGTGGGCTGGCATGAAGACTAGCAACGAGGATCGTCACATATCTTCCACTGAGCTCTTCCCTGGACCA
GTGTTTGGCGTTTTTGATGGTCACGGCGGAACTTTTACAGCAGATTTCTTAACGCGGCATCTTGTGAAAACTGTCGCCTCTGTAGTACGCCACCGCATTG
GGGGTAGAGCGTTCACTGTCCTGGAACGCTCCCAAGAGCAATCGAAGCAAGAGGAATCTGGCAAGGAGGCTATCATGGAGCAAATACAGCTACTGCGTCA
ACAGCTCGCTGAGCTGGAGTCTTTGAAAGACCCAGATTCGGAGAGCTCTGCTGATGAGATGCAAGTTTTGGTCGACCAACTTACGGATACCATCTCGCAG
TTGGACAGCGAAGTATCGCAAGTTAACGCTGAGCAAGCAATACGCCGAGAAGATCGAAGAAAATGGTATCATGAACAGCACGGACATTTCTTGAAATCTT
TCAAAGAAGCTTTTGATCGAGTGGATTCCCAAATCTTGCAGAAGAATTCGTCGCAAGATGGTTCTACCGCTCTCCTGGTTTGGTTTTTAGCTGACACAAT
CCGGTTTGACGGCGAAGACGACAATGGGTCACTAAGGGACGAGTTGAGCTTGTACACGGTGAACGTTGGCGACTGCCGTGCGGTCATGTGTCGTGGTGGC
CGCGGTGTAGCTCTGACAAGTGACCACAAACCGGATCGCCCCGACGAACAGCAGCGAATCGAGAAAGCGGGTGGCTTCGTGGGCAAGATAGCAGGCATAT
TTCGAGTCTACTCTGCTGCTGGTGCTGGGTTGGCTGTGGAGCGTGAGAAGTCGACGTATTTGGCAGTGTCACGTGCATTTGGCGACCGATCCCTGAAGAC
TCCGACATCGCTTGTTTCATGTGAGCCAGAGGTGAAGCGAGTAACAGTGCAAGATGACGATCTGTTCCTTGTCTTAGCCTGCGATGGCGTCTGGGACGTG
CTTAGCGAGCAAGAAGCGGTGAATATAGCATTGCCACACTTTCACGATGCTAAAGCCGCGGCTGATGCGATCGTCAAGGCAGCCTACAAGAAAGGAAGCG
TTGACAACCTCACAGCTACAGTCATTCAGTTCGGCTGGAAGCCCCATGAACGACTACGCTCTGTTCTCAAAAGCAGTAAGGCGAGTGCTTCTACAAAGAG
AAATGACGAAGCAGAGAAGGAAGAGGAGATTGACATGTTCAATCTTTAGTCCTACTCTCAAGTTTAGAGCCGTAGTTAAGAGTCTTAAGAGTCTTAACTA
CGGCGCGGTTGAGTTCCGTGATTCTTAGATAGGTTGATATCCTTGTTCGTATGAGGCGATGAGGTTCCGTTGTTGAAGAGTCTACATAACAACAATGATT
GTCGTTAAGCCGTGCGGATACGATACCAAGCAACGACAGGAACGAAAAAAAAACACCTCAGCAATCGACGTCATCGCATCGGCATCATACACTCGGAAGC
GCACAGGCGGTATATGCCGTCGATCTCTTCGCTTGTGTTTTCGTTGATTAAGTGCATATTGCTGGTCCACGAACACTTCAGCTTCTGCTCAAAGCTGCAG
ATCAAAACCACCTAAGAAAACATCAACAGGCAGCGCCGTACCCACGTGTGGGATGGCGAACCCAGCGTTCACTATCATCGCATGCAGTTTGGTCGCTGAA
TGCGGCGGCGGGGCGATGCGTAGCACGCGGTACTTGGTGTTCAAGTGCTGGTGCAGGAAGCCTACAACGGTTTCAAACTGCGAAAGGTGTGGCGTCAGAG
GACGTCGGATTCAAAGGATCAGTAGCTAGTCAACGCACGTCTTGCTCAATATTCGCCCCACGCCGTCCGCGCTCGCCCTCCAGTCGCGAGAGGCGATACG
TGGCGAACAGGATGGCGACGAGAATAACTGCAAAAGGCTGCATGTAAGGAGTCGATATCGAAAGGAACGAGTAAGGTCGGCCTGCGTACCTAGTGCGTGC
TTCCTCAGCGAGTCCAGCATG