Description :
From Genome Similarity Track
Location :
Scaffold_305:12415- 13732
Sequence
1317 bases(100 bases per row)
GACGACGCATCCGTCAGCAACCTCGTAGATGACTTCAGCGATACGGTTCAGCTTCATCAGCTCTAATACTCGGTCGTCCGACGATACCACCGTAGACTTC
TTGCACTCGAGAGTCTCGCTTTCCAGAGAGTCGGCCGCAGCGTTAAACTCTCTCACCACATGCAGGTACTTCACCGACCGCAGTTTGGCCGTGATTTCTT
GTGGTGAATGAGTTGTTGCAGCAATGACTCCTTCCGGCAGGCTACCACCCCTAGGGCTTGCTGGATCGCGAGCCTCGAATCGCCAACGACGACTAGATCG
TCGGCTCCATGCTGTAATGCAGCAGAGACGCCGTTGTTCATTCCGGTGTACTCAGCGAGGTTGACCGTGGTGTTCTCGAGGTAAGCGCTCGCGGCAAGCA
CTACAGTCGACTCTGGTAGCTTCCATAGTATCCACGAGCAACTGCCATATCCACCATTCTTCTTGGTCTTCGCAGACCCGTCAAACGACATAACGAAGCC
TCGATAGGACTGCGGTAGGCGTGCGTAGAGCAGATGCGGGTCCAAACGAGCAGTCGGTGGCCCTCGCGTCCGGGTGTTACCAACGCCAGTGACTTATCCA
AATCAACGAAATTCGTCAGGCCGGCTTGGAGTAGCTGGGCGAACGAACAGTCGGTTTCTTTGACTCGTTCGACCAATAGGTGCCACGGTGACAGCAAGAC
GGCGAACTGGGGAGCCCGACCGAACAATGTCTTGGACTTGTGGACCCAGTCGAGTGTCGAAAACCGAGTGCAGACCCGGACTCGCTGTCCAACGAGTTGA
GTATAACACACCTTCAGTATCAGCAGAAGCGCGAGGACCTCTTTCTCGGCCGGGTGATAATTCATCTCAGCATCCTTCAAAACACGTCCGCAGAAGCGAA
CGGGGTGTAGTTTGCCCTCGTGCTCTTGCATCAACGTGGAACTTAGAGCCCACTCGTTGGCAAACAGCATAACATGTACGTCCTTCTTCCGGTCAAAATG
TCGTAGTATCGGCGCTGCCGAGATCCTCTGTTGGAGCATCGCAAAGCTGTGCTTGGCCGCGGTGAGGTCACCCCCGGCTGGAAGTCCTCGTCCTTAAGCT
GGTACAGCGCTGCTCCATAGACCGCGACGTCTTGGATGAAGCGACTGTAATAGTTGAGTGCCCCAAGGAAGTACTGCATTCCTTTCCTCTTTGACGGGAA
CGGAAGCTCGGTCACCCCAGCCAGCTTCTTAGTGTCCGGTCGGATACCTTTTGCCGAGACTTTGTGGGACAGGAAGTCTACTTTGGACTGCACGAAGATG
CTCTTCGTGATGCTGAT