Description :
From Genome Similarity Track
Location :
contig_82:124080- 125952
Transcript NameFunction/comments
g12652.t1hypothetical protein

Sequence
1872 bases(100 bases per row)
TTCAAGATCAAGCGCAAAGCGGACGGCTCGATCGAGAAGTACAAGGCGCGCCTCGTGGCCAAGGGCTTCAAGCAGAAGTACGGCATCGACTACACGGAGA
CGTTCTCGCCCGTGGTCAAGTACGTGACGCTGCGCATGATCATCGCGATCGCCAAGTACTTCGGCTGGCCCCTCGACCAACTCGACGTCGTGACAGCGTT
CCTGTACGGGGTCATGAAGGAGGTGGTGTTCTGCGTGGTTCCCGAAGGCGTCGAACTGGATGGTGGCTTCGACTGCCTGGAACTGGTGAAGGCCATCTAC
GGTCTCAAGCAAGCTTCGCGCGTGTGGAACGAGACCTTCGACGAGTTCATGTGCTCTATCGGCTTCCAAGTGTCGGCCTTCGATCCGTGCCTCTACATCA
AGGTGGTGGACGGTCACTGCGTGCTCGTGCTGGTGTACGTGGACGACGTGCTGATTACCGGGAGTTCGCCGAGCTGATCTCGCGCACGAAGACGGACCTG
AAGACGCGCTTCGAGATGACCGACAGCGGCAAGTGCGCGTTTGTTCTTGGGATCGAGCTGGTGGACGGCCCGGACGGCAGCGTGACCATGTGCCAGCGTC
GCTACGTGGACGACATCCTGAAACGCTTCGCCATGGACGAGTGCAAGGCTGTGGTGAGTCCGGTGGACATGAGCACTCGACTGGTTCCAAGCGACGCGGC
GACCAAGGTGAACGCTCCGTTTCGCGAAGCTGTTGGTGCGCTGATGCACCTGATGACCGCCACGCGCCCGGACATCGCGTACGCCGTTGGCTATGTGTCG
CGCTTCATGGAGAACCCCCAAGAGGAACACTGGGTTGCGGTCAAGCGCATCTTTCGCTACCTGCAAGGCACCAAGACGCATGGCATCTGCTTCAAGCCGG
GCGACAAGATCGACTTTCGTGGCTACTCGGACGCGGACTGGGCCGGCGACCTCGCGGACCGCAAGTCCACTTCAGGCTACGTTCATGCTGATGAGTGCGC
CTGTGAGCTGGGGAAGCAAGAAGCAGTCAAGTGTGTCGCTGTCCACGAGCGAAGCGGAGTACATCGCGCTCAGTCTGGCTATCCAAGAGGGCAAGTGGAT
CCATCGCCTGCTGTGCGAGATTCTGGCGGCTGCCAACGAGACGGGACCCGAGCTCATGATCCGCGAAGACAACCAGTCGTGCATCAAGATGACCAAGAAC
CCGGTGAACCACGGCCGCGCCAAGCACATCGACATCAAGTACCACCACATCCGCGACGAAGTGAAACGCGGTGAAGTGAAGCTCGAGTATTGCGAGACTT
CTGTGATGCTGGCGGACATCATGACCAAGGCGCTTGCGGGACCACGCCACACGGAGCTGACGGCGGCTCTCGGCATTCATGGGACTTCGCATTGAGGGGG
CGTATTGAGGGTATGGAGGGTTACCGGTTTGGTATCGGTTGTTGACCGTGAACCGGTTAACCCGAACCGGTCCAATCCGAACCCACGCCGATTACGCCAC
CGACGATTACGCCACTGTCGATTACGCTACCTGTGGGTACAAGATTGTAGGTACAAGATGGGCTTCGACGTGGCGCTCTCTCATTGGCTGAAGTAACTCA
GTATCCAGTAAAGAATCAAGTAGTGTGTATCCAGTAGGTCTAGAGTAGCGAGAAGGCTAGCGAGCTAAAGACCTCAATCAATCACTTTCGAATCTTCGTT
CTACCCCTCAAGTGGTTTCCAGTTTCCGCTCCGGTCTCGCCCAGAGTGCTGCCGTCCCTCCGCTCCGTCAAGCTTCACGGTGTCAAGATCCATACCCTTC
CATCAGCGACGGATCAAGATTCGTCGCAGTCGGATGAAGACGACAACGAAGAAGAGGAAGCTGCGCGGGACG