Description :
From Genome Similarity Track
Location :
Scaffold_1058:12407- 14655
Transcript NameFunction/comments
Phypl_g12211hypothetical protein

Sequence
2248 bases(100 bases per row)
TGCCTCAGGCTGACTGTATATTTGTATGTCTACATGTTTGTGCCATATGCGGCCGCCTCTGCTGTTTGTGGGTGGTGTGCTAGCTTGCATTGAGGTTAAC
ATTGCTGTTCCGCAAGGAGGTTAAGCATTGTGTTCGATGCTGTATTCAAATTACATGTTCGCGTACTCTGTGGCGAGGTTAATTTTGCTGTTCCATCCGG
AGGTTAACCTTAGTGTTCACTACGGGGTTACCCATGCACCACTCACCTACTAAAGCTCGTAATACACCTGCGGTTTGCTCCGTACTCGATTGCTGCATAT
TGTTCAGTGTCGTTCAGCGAGTTGTCCTCCGCAACCTCGTCTTCGAAGAAGGTCTtgcggacaagaaggcggcgctcttcctcgaaggAAGCGACAAGCT
TCTCGCTCAAGTGAACCTTTGGCTCCCAAATGGGCTGCCACTCGACCAGGTAGTACGCAACTCGTCGTTGAGCTTGTGACGTAGTGCACCGGTTTGTCCT
TGCGGTCATCGGCAGCGCTCTGCTCcgaggcgtcgtcgtccgcatAAGCAGAAGGTGCGAGCCACCCGCGTGCGTCTTTAAGGCCGACCCTGCGCTTCTT
CCGTTAGGCGAGCGGCGCGATGATAACGTCGGTCGCTTCGGGTAGAAGGCCTGCGGAGGCGACCGAAGTGTTCATCGTAAACTGCTGGTGACAGATGACC
CCATTACTCACGTGAATCTTGTGAATCTTGTGAATATTGCTAGCAGCAATGAACAGAGCCTTAAACTCATTCGCAGAGCTGACGGCGTTCTTCGTTGGCC
TCGGCGCGGATATGATGGCCGTGTTGTGCACGGTGGAGTCTCGAAAGCAAAGTGGAGAGTGGTAAGATAAGCATCAAGACAAGCGCACATAGCAATGGAA
GGCACGGACAACACGGAGGTAAAGTATGCGTAATTACGCAGCGGGTATTAACCCAACGAGGTATGTAGTATGCACATGTGCAGGGTCAATAATGCGACCT
GCCGCCTGAAGCTGCTTGTAGTGTCGGATAAGAGTGTTGAGATGGCCGGCCTTGTGAAGCTTGCGCATAGACTCGAGGACATTCTGATCTCCGCAGGCTT
TGATCTTGTGCTCGGACAGTAGCTCCTTCTCAGTGGTTGCGCCAAACTCCAGCACATCTCATCGGTACTGCGGCGACTTTTCGTCAAGCACGAAGCCTTC
AGCGAGGAACAACTTCAAGAACGCAGCGACCAGCTTGGCGTTAGACCTCGTGTGCCTGTTGGCGTCTTCGGTTGAGCTCCAGATTCGGAACTCTTGGGCG
TATCATGAGAACCAGACGTCCTTCagtttgttgctgctgctgcacggcatcTCTTTGCTGGTGGATCATTGCTTGTGTCTCACCTGTTGCGCATTGTTGT
AGATTTTAGCTTCCACCGTAGACAGCCGAACGTCGAGCTTGTCGTTGATCTATCTTAACTGCTCAATTAAGGCGGCTTGGTGAAGAAACGTTGGGTGCAT
GGTGATattgctggtgctgtcgtgGGAATTGGTGTTGTCGGCttggaggggggggggctcgTGTAACAGGCCGGGTGCGAAGACCAAGCTAGAAGCTCAT
TATTGATGTGGCTTTattttcttcttttttttgGATGGCACGCGCTTTGAGAcgctcgacagcaagtcCACCTGActtgatctgcttcagcgattGAtag
tggcgcagcaggtaTATCACAAGAGTATCAAGACCCTTCCATTCACGTTGTACGGCGCTGTCTTGAGTCCGTAGGATGCGTTCAATAGCGCCGAGGCGAC
GGTTTGAATCTTCGTATGGGTGTCGGAGTCGAACCATTATAGCGACAAAAGAGGAACAACTTGATCGgaaccccccccccccacacacacacacactcaC
ACGCACACTCACGTCGCGAGCAACCTTGCGACCTTCGGTCGGTGTGTTGAAGACGTACGCGAAGGCCttgctcgtcgctgtcatGTCCCCCCCCCCGGTC
GAAACCAATTGCATATACATGCCGGTTCTATTGGCGTGGTGTGCTCCTCCGCGTCATAAAGAATGCGATGTCAGGCGCTCGGTCACACCAGCTTTGTTAG
CGACTCTCTCCAGGACGCGGCTGACGTACCTGTGGGTGCCTGGGTTGTCATGCCTTCATCCAAGCGAGTTGCTTGTAGTGGCACCGCAGGTCCTGGGTGG
TCGGTCGAGTCGATGAGAGGCGTACCAGGAGTAAGAGTGGCTTGGGAG