Description :
From Genome Similarity Track
Location :
Scaffold_139:124067- 129449
Transcript NameFunction/comments
Phyin_T30-4PITG_20386Eukaryotic translation initiation factor 5B
Phyin_T30-4PITG_20387Putative uncharacterized protein
Phyin_T30-4PITG_20388Putative uncharacterized protein

Sequence
5382 bases(100 bases per row)
AATCGTGTGAGCCATTGATTGCCGAGCCCCAAACCAGAAATCCTCCGCTGAAGACGAATTGAGCCGCGATGGCTCCGAAAAAAGGGAAAAAGAACTCCAA
GAAGAACGCCGTCACGGCTGCTGGCTCGGATGACCTGGATGACCTGCTGAATGAGTTTGCTCCCACGAACACTGCCAAGCAGCAGCCCAACCAGGAGGAT
GAGAAGGAAGACCAATCGCAGGAGAAGGAGTCGGACGTGGATGCCGCTGCCGCCGCGTACCTGGCGTCTCTTGGTGTGGCTCCTGTCGCCGGAGGTGAGA
AGAAGGACGACAAGAAGAAGAAGAAAAAGGGCAAGAAGAAGCCGAATGCCGACGTTAAGAAGGACGACGATAAGAAACCCATGTCGGCTGCAGCCAAGGC
CCTGATGGAGCGCCAGACAGCCATTAAGGCCGAGCAGGAGCGTGTCGAGCAGGAGCGTCTGGAGCAGGAGCGCATCGCCGAGGAGGAAGAGGCCAAGCGC
CTGGCAGAGATTGAGCGGGAGGAGGAGATCCGACGCAAGAAGAAAGAGGCGCGCGCCGCCAAGATCGAGCGTCAGAAAAAAGAGGGTACGTACATGACCA
AGGCTCAAAAGCAGAAGGCGGCCAAAGCCCAGGCTGCTCTCGAGGCCATGCAACAGGCGGGTCTCGTTCCCGATGCTGCTGGCGAGAAGAAGAAGGTTGT
GTACTCGGACCACAAGAAGAAAAACAAGAAGAACAACAAGAAGGAGGAGTCCACGAATGAAGAGCCCAAAAAGGTCGAGTCCAAGCCTGTGGAGAAGGAA
GAGGACGTGGACGACTGGGAGGCGGCAGAAGATGCCGCTCAGGCGCAGGAGGAGGAGGCGGAGGCCCCCGATGCCTGGGATGACGAGGACTGGGAGACCA
GCGATGTTGTGGCCTCGCTGGAGGACAAACTGCTGGAAGTCAAAGAAGAGGATGCCGCTGCCGATAGCGACAGCGAGGGAGACGAGGATCTGCTGGTGCT
GGAGCAAAAGAAGGAGCAGGAGCGTCTGCGTCAACAGGGAATCGCTCTGAAGAAGCGCCAGGAGGAGCAGGCCGAGCAGATGCGTCTGGACGCCGAGGAG
GAACGTCAGCGCTCCAAGGCAAAGCTCGAGGCTGATCGAAAGAAGAAGGAGGCAGCTGAGCGTCGTCATAAGCGCGAGGCCGCTGCTCGTGCCAACGTGT
CCTTGGATAACCTACGATCGCCTATTTGCTGTATCATGGGGCACGTCGATACTGGTAAGACAAAGCTTCTTGACAACATTCGCAAGACCAAGGTGCAGGA
CGCCGAAGCTGGTGGTATTACTCAACAAATTGGTGCGACTTTCTTCCCTGTGGAGGCTATTAAGCAGAAAACGGCACGCCTTGCCGAGACAATGAAGCTG
GAGTACCGCTTGCCTGGTCTCCTCGTGATTGATACGCCCGGTCACGAGTCGTTCACGAATCTGCGTACACGTGGTTCATCGCTCTGTGATATCGCCATTC
TGGTGGTGGATATCATGCACGGTCTGGAGCCGCAGACTCTGGAGTCACTGCGTCTGCTGCGTCAGAAGAAGGCCCCGTTTGTGGTGGCCCTTAACAAGAT
CGATCGTTGTTACGGCTGGAAAACCATGCCCGACATGCCCGTGCAGGAGGCACTGAAGCACCAGAACGAGCACGTTATTCGCGAGTTCGAGGATCGCATG
AAGGCGATCATTGTGGAGTTTGCTGAGCAAAAGCTGAATGCTGAGGTGTACTGGCGCAACAAGGACTTGGCCCACACGGTATCTCTCATCCCGACTAGTG
CTATCTCAGGTGAAGGTGTGGCGGACCTGTTGATGATGCTGACGCGGTTGACACAGGAGCGCATGGCCAAGTCGCTGGCGTTCGTCGACATCCTGCAGTG
TACCGTGCTGGAAGTGAAGGTCATTGAAGGTCTTGGTACAACGATTGATACGATTCTGGTGAACGGTACACTAGAGGAAGGTGCAACCATTGTTGTTTGT
ACGCTGGACGGACCAGTTGTGACAACGATCCGTTCTTTGCTGACTCCGCACCCTATGAAGGAGATCCGTGTCAAGGGCGAGTACCTTCACCACCAGAAGA
TGAAGGCCGCTATGGGTGTGAAGATTTGCGCTCAGGGCCTTGAGAAGGCAGTCGCCGGTACGCAGATTTACGTGGTCGGCCCCGATGATGACGTTGAGGA
GCTGAAGGATTCCGTCATGTCCGATCTGACGGGTATTCTGGACTCCGTGAAGGCTACCCGCCGCGGTGTCATGGTTCAGGCGTCCACCCTCGGTGCCTTG
GAGGCGCTTCTGGAGTTCTTGCGCACGTGTGACCCGCCAATTCCAGTGTCCTGCGTGAACATCGGCCCAGTCCACAAGAAGGACGTCATGCGTGCTTCGG
TGCAGCTGGAGCACCAGCCTGAGTTTGCCACCATCCTGGCGTTCGATGTGAAAGTCCACAGTGACGCTACTGAGCTGGCCACAGAGCTTGGGGTGCGCAT
TTTCACTGCCGATATCATTTACCACCTGTTTGATCAGTTCACGGCGTACATGGACAACTTCCGCATGGCTCGTCGTGAGGAGTTCGCCGAGGTGGCTGTA
TTCCCGTGTGTGCTGAAGATTCTGCCCAATTGCGTTTTCAACAAGAAAGACCCGATTATTCTTGGTGTGGACGTCGAGGAAGGTATCCTCAAGATCGGTA
CCCCCCTCGTGGTGCCGTCCGCCGCCGGTTTCCTGGTCGGCAAGGTGGGCTCTATTGAACGTGAGCATAAGGAGGTGGACCGCGCCAAGAAGGGAGCGTC
TGTGGCCGTTCGGATAGACAACGAGGGGAGCGTCATGTACGGCCGTCACTTCGACCACAAGGACAAACTGGTGTCGCGTCTGACCCGTCAGAGCATCGAC
GCACTCAAGGAGAATTTCCGGGAAGACTTGCAGAAGGAGGATTGGCAGCTCGTCATCAAGCTCAAAAAGGTGTTCGATATCATTTAGAAAGCGCAAGTTA
CGCGCAGGAATAACAGGGAATGTTCGTGCCCAGAGGGTGTCCAGAGGATTTCCTGTTGAAATCAGAGCAGTTTTCCTACCAGCGAGTGCAGTTGTGTCTA
GCAATACATGATTTTCGTGCAACACTGTTTTCGTCGACATACATGAGCTCCACGGGATGGAGTTCAGTCTACCTGTACAGGTACGCCATAGGTGAATCAA
ATCAGCGTCGCATTACCAACCTCCCCGAAGCAGCTCACCGTCAACCAGGGGGTGGAGTGGATGAGCAGGGTGCGTGTGTGCAAGGATTCGCTTAGCCCTA
TTAGCCCAACGGTAAAATATAAATAAATGCTTATGCGGTTAGGAATGCCCAGGGCAATTTTCAAGCTGTCGTAGGATAACAGGATAAGTCTGGAGACCAT
TGAAGTCCCGCTTAGTCTTTTTAACAGTTATGAGCAGCGCTGCTGTTTCATACCGATAAGGTATAGCTGAACGGTGGGAGAGCTCAGCTCCGATGCAGGA
CTCGAAGGTTCAGTGGTTGACCTGGAGTCTCCAGGTCACAGTGGAGATCACTTCCGACTCGATTGTCTTCGCTTGTACATGTAGTCCTCGTGGAACGAAG
ACCGACAAAGCGGCTTCGAACTGGAGGGCTTTGAAAGCCCTCCAATTCGAATCGGCGCATGCACTTGAGGTGTAGATGAAGTACCGGTAACTGCATCGCC
TCATTGTGTTTCGTTGACACAACAGATCAGTTGCAGTAAAATCTCTATACCAAGCTTTTAGTGACTCGTTGCAACTACATTTAGTTGTACGAGTCTTACG
AAGACATTAGGTCTGAACGACCTGTTCGCCTGTCGGAGTTGAAGTGGTCACGGTTCTTACCAAAGTTAAAAATATCCAGGTTGTATCGCCGTCGTGATGA
CGAGCCTATCTGGATTAGGTTCAGGGAGTTATCCTCATGAGTCGTAACAAATTTGCTTGCGGCCAAGCAGCATTGTAGGAGCGCAACGCAGGACAAGGAT
TGGATCCAAATTGAAGATGAACAGCTGGATTTGCAAAGTCAGTTCGAGACCAAATCTGTTCAGGAGCGACAGCCGAAAGTACATGCGTCAGCAGCTCAGG
CCTGAACATTTCAACCAGGCGGCGGGGGATGAAGCAAGCAGATTCTTCTCCAGCCGAACGCGGGGAACCGCGCAGTTCAGCGGCGTTGCGGCCGCGCTGA
CCTCAAGCGTGAAGCAACGTGCAAAATAGAACTTCCGCGTACGTGGTCTCTTGCTTTTGTGAGTACAGTACCGATATGTGTGTCTGGGTGACCTATCGTC
AAAGACACCACGTCATGGTATAATATTCGCGAAGCCAATCGCGGCGGTGGCACGAAGAGCCTCACTTTGAAATTGGATCTCCTTCGAGCAGCTCCTGTCT
TTTCAATCAGCGCGCCATGATGCACAGAATGCGGATATCGCCTATGCAACAGTTCAGCGACCCGGGGCGCATTAATGTGGGCGTTGTTGCCTCAAACATT
ACCTCCAAGCCGAGCACACTGCGTGCGATGCGGGTACCTAAATTCCTACGCAGTTTGTATGACATTCTCCACTACGAGGACCAGTCCATCTTAACGTGGT
CCAAGGACGGCACCTACTTCCAGATCTTCGATACCAAGCGACTCGAGATCGTTGTGCTGCCCAAGTACTTCAAGCACGGTAAATTCGCCAGTTTCCAGCG
CCAACTGAACAACTTTGGCTTCCGCAAATGGACCAAGACACAGTCCAGCGTCTGTACGTTCAGCCACCACCATCTCGTTCGTTGCCACCCGCAACAGCTG
GCTGAGTTCATCAGTCGACGCCCTCCTTCCAACGGCATGCGCTCAGATGTTGACGCCTCGTCGGCTAAGCGTAAGAGGACATTCACGGAATTGATGCGAT
CCGGAGATACTGGGACTTCCGCTGCCGCGAAGATGATCAAGCGGGAAAACGACAGTTTCAACAGGACGGAAGGCCACGAGCTGGCCATCGCGACGAACTC
CCCTCTAGCCAAAGGTGTGCCACGATGGGTGGCAGACCCTGTGGGTTTTTTGAAGGCCAGTGAAGAGAAGAATGCGACGCCCACGAGCACGTCGTCAGAG
CAGGCGTTCAATTTCTCGATGGAGGAGCTGCATAACATCATTTTACCTGTGGCGTCCACATCGGAGCGCCAAGACAGCAGGTCGATGGAGAAAATGCTCG
AGTTGCGCATGTTGAACGAGTGTTTGGATCTCGGAACGGCTAGTTCATTAAGCACCACTTTGAACCCCGCGGGTGGCGAGCTCTTCCCGTCGTTTCCCTT
TTCTTGGGATAGCGACACATTTTTCGCTCCAGTTGGCCGTGCCCACGTCGAGCAGGAGCGCGGTTTGTGGAGATTACATTAA