Description :
From Genome Similarity Track
Location :
Scaffold_376:12401- 15200
Sequence
2799 bases(100 bases per row)
GTAGGAACCGGATGCTAGATCCGGGGAACCTCTACCTAAGGGCACGGCGACCGAGGGGACGTTGGGATGCCTAATTATGGTGAGCTTTGCACCGACCGGG
ATCTGGAGGGAAATTTAGACGCCCTCGCGACTTGAGAAAACCAGGATCAGGGGACTTGAGCGGAAGGGGGACTGGCGTCAAGTCTAAGGAACGGAAGGGG
GATTTGGACAGGCGAGTCCAATCAGTTGAAGTTTTAGGGGCGGGCACCGCGCCACCTCTGGGAGACGGAGGGTCACCAGGTAACATTGGCATTCCGGGTG
CAGCCGATGCCTTGGTACAATTAATCTCAAAGTAATCGTACACGAGCCTGTTTCAGGACATCAAGAATGCACAGATTAATGAATGTGGTGTAGGGATTTT
TTTATCAGGAATAATGATGGTTACAGTCAGCGAGAGAGTCGATCGACGAAAAACCGAGGTCGGCGAACCAAGGTCGACGAATCGTAGTCGGCAAAGAGTG
GTCATCGAGTCGCGGTTGGCGAACCTTGTTCGGCCGAACTGATGTTGGTAAACTGCGATCTTTGAAGCCTAGATTGGCGAGCTCGGAAGTTGATGGACGT
GTTTAACTAGCCGAGTGATAGAAGATCCGAAATACGTTTTATCAGGTATATATGAGAGAAGGGTATAGAACATTCGAAATACGTATCATTAGGTATATAT
ATAGAAGAAAGGGTAGAACGACAGGAAACCACACAAAACGGCTCCACGATATAGCAAAAGAGATAACCCAAAATACAGTGCAGAATTTCTAAGTCCTAGG
CACGCGTACACTTTTCCGGTAAGTATATGGGAGGGCTAGATCACGCCTGCCGTCGAACCTCGATAGACATAGCTTGTAGATATTTTGGTAGTGCTAAGAG
ATTGGGACGGCCCGGGTTGGGTAACACTCGCTACAAGCGAAAGGAAGAGCCTCGTCGACGACGAGCCGGTAAAAACCAATTAATGGGATCGTTTTGAGTC
TCGTCGAACGACGATGAGCATCAGCAGAACAGCAGAAGGCACTAAAACTTGTCTTAGTGACGAGCCGGTGGGCCTCAGCCGAGGGCGCCGAAATTCTTCT
AGTCGGGCGTACGCTTTGCGAGCCGGTGACCTGTAAAAGCGCGTAGATCGACGGCTTCTACCCTTTGGTGTGAAGTCACAAGAGTGTGAGGCCTTTAGAA
TCTGCTGATCTCAGGCAGTCTTCTGGAGGAAATGTTATGAGGAATTGGTTGGACGAAAACCACAACTTAACGCGAAGGGGCGAACCGCGAAGGGATTTTA
TTTTAGCGTACTAGCCCATTTCTCCGACCTAAATCGGCGATTGTTGTGTTTGTGCATTGAGGCTGCATTGATATAGATTTGATTAACTACTTTACCTTAA
CAGGTGCCACGACCCGGGATTTCAAGGTGTGCAATTATTTTAAGATCTACCAAGCAACCAACTAAGAGCTATATGGTCATCCATTCGAAACAAGCAAGCG
ACATAATTGCAGCTATGCGCGTGTGGCGCAGTAGAATTAAGTGAGATCGAGGGACGCCGACGCCGACGCGAAGGTGGGGAGAGCCATTGGGTTCGCGATA
TTCGAGATAGATGACCAAGTGGTGGATGAAGAAAAAGTAATATCCATGTAATATGGTGGAAGGGTATCCGAGGAAGAGGAGAAATAGCGTGTGTTACACG
CGGGACGTGCTAATCAAAAACACGCGGTGAAGTACTACATAAGGGCTACGTAAAGCCCAAGCGTGAGGAGGAGGATGAAAAAGAGCAAGTGTATACTATC
GATGAACTACCATCACTGATCTTTCGAGCGGCGAAAAATTACACTACACCTGAAGCGAACCGAATTATCCACCGCATCGACGAATAGGTGAAGAAGAGCA
AGTGGAATGGACCATTCATCCTCGAGCGATTAACGCAATCGAAATGGGAGAACCTGAGCACCGTGCTTAATACAAGACCTGAAACCGACGCGACTATCTA
CCTACACGGTGGTACTCGTGGACGCTATTGGATATAAGTGTAACACTGTACCGAGCCCCAAGTTTATGAGAGCAAACTGTTACTTACGTGCGGTGAAGAT
TGAGTTAAAAGGTGGATGGACATGTTGAAAGAAGAGTTTGGCGTTGAGTCAGGTCCAAGCGTCCATGAGACTAGGCGTCGATTGTTGCAAAGGGACATGG
ATCTGGATGAAGACAAGGCCCCGGTACCAGCACGATACGAGTATAAGGCTACGTCGAACGAAGGTCAAGGGTTGGCGAGCGTTCACGGAACCACGAATGC
AAGAGCGAGGCAAGAAGTATCATCCCGAGTGGAAGGGTCGACTTACTTCGAAGACTCTCATAGGGTGACTCCAAAGGGATCACCACCAACGAGAGGACGA
CGACAAGAAACATTCGTCGAGCCGAGGAAAAAATGGTGACGCAACTGCGTTTGATGACGACGATAAAGACCATTGAAATAGACAACGTCAAACCAGTCAC
CCAACGGACGACTTCGTTCGCTGACCGAGTTTCGATGGGTCAGGAAGCAAACGCGGACAGGTGATAGAAATAAGGACGCATGCCCCAATGGAACAGATTG
CCAAGTTCGATAGTGATACCGTCGGATGATGCACCTCAATGGATCAAGCAGTTTATGCACGAGACGAAGGGTACGTACCCATCCCAAAACGAGTGGTTTG
AACCGTTCTCGCTAAGTTTCGGAAAGGCAGCTAAGAGCTGGTACCGGCCGCTGTCAAGGAAGACAAAGCAAACATGGAAATTGCTTAGCGCAGATTACG