Description :
From Genome Similarity Track
Location :
Scaffold_154:12400- 15656
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_154-snap-gene-0.19Pro-apoptotic serine protease
Pytul_var.sporangiiferumsnap_masked-pug3_contig_154-abinit-gene-0.33Pro-apoptotic serine protease nma111

Sequence
3256 bases(100 bases per row)
GAAAAGCAACTGAGTGCGCGACTGGCAGCTGAGTTGATCGCGGCCGAGGCCAAGCACAACACTGGCGACTGGAAGAGCACGCTCGAGCGCGTTGTGCCAG
CGATCGTGTCGCTGAAGCTGAACTCGCCCAAGGTTTGTTTAGATGCATTCTGCGGCTGGTAATATTCGCGGGCATACGTAATTGACTGCGAAGCGCATTA
TCTAGTTCTTTGATACCGAATCACCAGGCAATGGTTCTGCAACAGGCTTCGTCGTGGACGCCGAGAAGGGTATCATCTTGACGAATCGACACGTCGTCGG
TCCGGGTCCAATCGTACGATTTGCGCTTATTTATTGCATTCGATATGGAAGTTGTCGTAACGTGTTAATGCTTCGATGATGCAGGATGCAGAAGCCGTGT
TCCAGAACAACGAAGAAGTCCGCATCATCCCCATTTACAGGGACCCCGTGCACGACTTTGGTTTCTTTCAGTACAACCCAGCAGTAAGTATTTCAAAGCC
GCGTATTTACGACCGCCCTGAGTGTCGACAGCGTATTAACAATTTCTGACGACCGCCTATCCACGCGACAGGACGTGAAGCACATCTCCGTCCCGTCGTT
GTCGCTTCGTCCAGAGAAGGCGTGCGTCGGCACCGACATCCGCGTGGTCGGGAATGACGCGGCGGAAAAGCTGGCGATCGNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNTCGACCGCGATGCACCCATGTATGGCTATAATAACTACAATGACTTCAACACGTTCTACTTCCAGGCGTCGTCAGGAACGACAGGTGGAT
CTTCTGGTTCCCCCGTTCTCAACCACGAGGGCGAAGCGATTGCGCTGAATGCTGGCGGCAAGATTGGCACGTCAGCCTCATTTTACCTACCATTGGACCG
TGTGAAGCGAGCGCTCGAGTTGATTCAACAGGGGCGCGAAGTGCAACGCGGCACGATCCAAACGGTATTCCAGTACAAGGTGAGCCGTTGGCATTGTGGT
TGAACCTGATACGCTGATATCTAACGATCTGGCATGTGTGCTCATGTGTGATGGCCATTGTAGCCCTTCGATGAAGTGCGACGACTTGGTGTGAATCCCG
ACACGGAGGCGCTCGTGCGCTCGACATATCCACTCGAGACCGGGATGCTCACAGTGTCGGAGACCATCCCCAACGGTCCGTCCAACAAGAAGCTTCTCCC
TGGCGACGTGCTTGTGCGTGTGAATGGCGAGCTGATCACCCGTTTTGTGCCGCTGGAGGCGATCATTGACGAGCATGTGGGTAAATCCATCGACGTTCAG
ATTGAACGCTCGGGTGAGCTGCTTTCGTTTGCTATCGACGTGCAAGACCTCCATGCGATCACGCCGTCCAGGTTCATGGAAATCGGTGGCGCAGTGATCA
ACCCGTTGTCGTACCAGCAAGCGAGAAATCATGCGATGAGCCCAGGCGCGCCATACGTCGCTGATCCAGGCTACTTTTTGCAGCGCTCTCGGANNNNNNN
NNNNNNNNNNNNTGCGATCATCCACTCGGTGAATGGCGTCAAGACGCCAGATTTTGACTCGCTCAAGAATTTCTTCATCACGTGCCCTGACGGCGAGCGC
GTGGTCGTGAAATTTTCGAATCTGACTGACAAGTCCGAGAAGATGGAGGTTGTCCACATCGATCGCCGATGGTTCCCGTTCTGCGAGTGCACACGCGACG
ATACGCTCGGAACGTGGCATTGCGAGAATTTGGATGTGAAAGCCGTGAGCGCTGAGAGCGAATCAGACTCGAAGGCAAAGAAGAACGGAAGCAAAGCCAT
CGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGAAAAACAAGGTGGAGGCGAAACTCGCACGTTCGCTCGTGACTGTGGACTTTGATCGGCCATTCAG
CGTCAACAGTTTGTCGACGTCCAACTACCGCGGCACGGGGCTTGTCATCGATGCGACCAAGGGACTGGTCGTCGTCGACCGGAACACAGTCACCGACAAC
TTGGGCGACGCCATGGTCACGTTTGCGAGCACGATCATGGTCCCGGCCCAGGTTGTGTTTGTGCACCCGGTGCACAACTTCGCGATCGTGCAGTACGACC
CGAAGCTCATTGGCTCGACGCCGATTGAGAGCTGCAAGATCTCTCAGACCAAGTTGAAGCCTTCGGAGCCCGTGTGGCTCGTTGGTTTGATGANNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACCTTGTGTCTCGTGAGACCATTGTCTCGGGGATCAAGTGGATCGGATTGCCGATGC
CCAACCCACCTCGGTATCAGGAGCACAACCTCGAGATGGTCGCGTTGCAGGACATCGTGGGCACGGAAGGTGGTGTCGTGTGCAGTCCCGATGGCGAGGT
CGAAGCGTTCTGGGCGTCATTTTCTTTCCAGCAGCAGCGAGGCGGTCAGAAAGTGGAAAGCCAATTCAATCGCGGCATCCCGATCGACATCATCATGGAG
AGCGCGGCGCCGCTGATGGAAGGCAAGTCGCCCGAGCTGTGGGATCTGGGCGTCGACTTTGAGCACATCAGTCTCGCAAAGGGCCGCGAACTTGGCTTGG
AACAGTCTCTCGCTGAGAGCCTTGAGAAGGATGCGCCAGATCGTCGCACGATCCTGAGCGTCTCGCGCCGATGGNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNGCAAAAGTGCTCAAGAATGGCGATATCCTCGTCGCTGTAGACGGTAAGATCGTCACGTCGTTCCGCGAAGTTGAGAAGTGCACGCAGAAGCCCGAAG
TGCAGCTCACGATCGTTCGAGACGGCCAGGAGATGAAAGTGGACGTGAAGACGCTGTTCATGGAGCGCACGGAGATCAACCGCATCGTGTTTTGGCAGGG
GTTATTGCTCCAAGCTCCACCGTTGTCCGTGTCGGCGCAGCGCAGCATCTCGTTGGAGGACGGCATCTACGTGTCGTGCCGNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCACCAACGAGCCGCATCCAGGAGATCGACGGCGTCAAGATCACGAGCATCGACGACTTTCTGGAGGTCGT
CAAGGCGAAATCTGCGAACGACTCGGTGCGCATTAAATACACCGACCTCAGTGGCAAGGACCGGCTCAGTACGCTGAAACTCGAGCCCAAGTACTGGCCC
ACGAACGAACTTGTGCATGAAAATGGCGAATGGCATCGTAGAAGCATTTAAAGAGC