Description :
From Genome Similarity Track
Location :
Scaffold_1403:1240- 2243
Transcript NameFunction/comments
g16730.t1hypothetical protein

Sequence
1003 bases(100 bases per row)
TCGTGCCGGATGATCATGAGCTGAAGCTCAAGATCACGTATGAGTACCACGATGCCCCGACATCGGAACATCCTGGCCGTGAGAAGACATACTTGCTTCT
CACGCGTGACTTCTACTGGAGTCACCAGTACAAGTGGGTACGCAAGTACGTTCGTGCTTGCGAGGTATGCCAGCGCGTGAAGCCTGCGCCCAACTCGCAG
GCTCCGCTTCAATCACTACCGACTCCGTCGGAATGCTGGCAGTCCATTTCAATGGACTTTGTTTTTGGTCTTCCGCAAGACAACAAGCGGAGGACTGGTA
TTGTGGTCTTTGTTGACCGCTTCAGAAAGATGGTGCATCTTGCTGCAGTACCAGCCGAGGTGACAGCCAAACAGACGGCATGTCTGTTTGTCGACATGGT
GTTTAGACACCATGGTATGCCACTAGACATCGTGTCGGATCGGGATCCGCGCTTTACAGCGCGATTCTGGCAAGAAGTGTGTACACTTCTTGGAACGCAG
TTGTCCATGTCGACTGCGGATCACCCGCAGACCGACGGACAAACAGAGCGTGTCAACCGCGTGCTGGTTGACACCATGAAGAGCTACGCGCACTCGTTCC
ATCAATGGAGCGACTGCTTGCCGATGGCGGAGTTCGCCATCAACAACTCGGTGCATGTATCGACAGGGCACACACCGTTCTACGTGAATGCCATGAGGCA
CCCACGCGTACCGAGCGTACTCGGTGCGGTAGCTCCTTCCTTAAGTGGGGGAGGATATCCGGTTAATTCCAAACAACCGGATAAGCACGCTGATACGAGC
AATGTATCAGCTGTGACGACTCGCGCACGTACTGCGCGCAGTCATGGCGACGACAACACTGTGTCTACGACGGGCGTAGACACTTTAAACGACAACGAAC
ATCACGCGCAGGCCGGGCCTGCTGCGAACAAGGAGCACGAACTGAACCAGGGGTTCAGCTCAGATGCAATGGACTTTGTCCAGCGTCGACAAGCCGTAAT
TCG