Description :
From Genome Similarity Track
Location :
scaffold_295:124- 2141
Transcript NameFunction/comments
g6930.t1 hypothetical protein PHYSODRAFT_262200
g6931.t1 putative polyprotein

Sequence
2017 bases(100 bases per row)
CGGGCATGAGGGCTGCGAACGTGTCGTGAGCTTCCAGCCACGGCAGATGATGCCCGCTGAGAATAATTATCCCGTCCACGACAAGGATCTCCTCGCGATG
CGCTACGCTCTGATTAAATTCAGAGTGTACCTCCTCGGAAAGCAGACGTTCGCGGTCTATACGGGCCACGCCTCCCTGCGAACCGCGATTAAGAGCCCAC
ATCTGTCCCAGCGGATGGCGCGGTGGTTGTCCTTCTTTGCCGAGTATAACTTCGTAGTCCATTACAACCCCGGCAAGAATAACATTCTTGTCGACGCGCT
ATCACGCCGTCCGGACTACGACCCACGCCGCGACGTTGGTCCTCAGGTACCTGATGACGAAGACGAAGATGAATGTGCTTGCTGCGTCGCGTTGGGTTTG
AACGCGACGGTATCGATTCCAGCGTCACCACTACGTCAGCTGATTGCTGAAGCATACGACGCTGACTCCTTCCACGCCGACATCATTGCGCACCTCCGGA
AACCCTGCGCCGAGTCGTTGAAGAAGTTGACGCGTCCGACACGCGACCAAATCGCGCGCTACCAGCTTGATGGATCTCTGCTGACGTATACGATGGACAC
TTTCGACGCTCCGCGAGTCGTCATTCCTGCCGATGACGACCTTCGAGCGCGCCTGGTTCATGAGTACCATGACTCTCCTGTTGGCGGACATCTCGGTCGC
GAGAAGACATTCGCCGCGCTCTCCCGAGATTGTTACTGGCCTCGGATGTACAAGTCGATACGGAAGTGGATCCGATCTTGCGAGACCTGTCAGCGCGTGA
AGCCCTCTCCATCGTCGCAAGCTCCTTTGCGGCCGCTTCCCATTCCTGCAGAAGCGTGGCGACCTGTCAGCATGGACTTCGTCTTCGGTCTACCGCCAGA
CAGCCAGGGCCGCACTGGTGCCCTGGTGCTCGTCGATCGCTTCAGCAAAATGGTCCACTTTGCTGCTGTCGCCGCCCAAGTTACCGCTGAGGAAACGGCC
AGTCTGTTCCTCGAACTTGTATTCCGGCACCATGGCCTGCCGGAATCTATCGTGTCCGACCGTGATCCCCGCTTTACTTCCGCGTTCTGGGACCGCCTCT
TGAAGCTTCTTGGTACGCGCCTCCTCATGTCAACGGCGGCCCATCCAGAGGCGGATGGGCAAACGGAGCGTGTGAACCGAGTCCTCGAAGACGTGCTGCG
CAGCTACGCGACAGCGTTCGAGTCATGGAGCTCTTTCCTGCCGCTGGCGGAGTTCGCCATCAACAATGCGAGTCACGCGTCCACGGGCTTGACCCCGTTC
TTCGTCAACAACACGCGTCACCCGCGCGTTCCCGCGATGATCGGCTTGACAACGCCTTCGGACGATATTGGCTCCACTCTTGGTGGGGGAGAAGATAAGG
CTACGCCGACGCTGTCGGCGCTATTGCCGAGTGAAGACGATAACGGGTTGGCGCTGGTACCTGGTACCAGTGCCGAAGCGGTGAACAGCATCGCGTCGAG
AACTCGATCGAAGGCTGCTACTCTATTGGCTATGGACACGGCGGACGTGACGGGTGGCGTCACGTCATCCGTGGCAAACTTCGCCCCAAACGAAGGTGCT
ACCCCGATCAGCTCCGCAGCTGTATCGGAGTTCATGCTTCAGCGTCAAGCCGTCACGCGATTCGTGCGTGACGCGCTGCATGCAGCCGTGGACAAGCAGA
AAGAGAATGCCGATAAAAGAGGTCGGAAGAACACGGTTGTCTTCAGACGTGGCGACCGCGTATTATTATCGACCACCGGAATTCAATCATCGGCAGTGAC
GAACTTGGGCGCAAACAAATTAGCACCAAGATTTATTGGTCCATTCAAGATTATGCGAGCTCATGGAGACGCCTACACGCTAGACATACCAACGGCGATG
CGCCTGCACCCGACGTTTTACGTCGGGCGTCTCAAGCCGTACCATCCTGCCGAGATCCCCGACTCCCATCCGCCGGTTCGCAGGCGGGCTCGTAATCGGC
GAAGTCGCTCGCGTCGC