Description :
From Genome Similarity Track
Location :
Scaffold_2419:124- 1874
Transcript NameFunction/comments
Phyag_g12455hypothetical protein

Sequence
1750 bases(100 bases per row)
CAGTCCGTGATACTCTGCATCGTTCACAGTCACATCCTCCAACGGGAATCCGTGCGCACTCACAACATGCCATCCAGGTAACTGCCACAAAATGCACCCA
CAGCTTCCCTGTCGCGTAGAGACTTTAGCGGCACCGTCGAAACTCAGAACGTATCCTTTATAGTCTGAACCGAGCATCTCCACACTGATCGGAGGAGGCG
CCTTGACTCGCCCCTTGGCCGGAATCAAATTCTCTGCGACTTGGTCCAAATGTTCTCTGGGGGTGATACCTGCTCCGAGGATGGCAGCCAATCCGTCTTC
GTCACGCTGCACACGGCGCAATTCCAGAGACCACTTCGACAGTTCTAGACCCCACTTCAAATGCCGACCATCGGCAGAGTTTGACTTCAGAAGCCACTTC
AAAACCGAGTACCTGGTGTAGACCACCACCGGGGCCCTGGAACCATAGATGAGAGGACGAAATTGTTCCAAAACGCGTAGGATCGCCAGGACCTCCTTCT
CTGCGATGTGGTACCGGAGCTCAAACTCGTTCAGGACACGCCCCGTGAACCGTACAGGCTGGATAACACCGTCATGTTCCTGGCCGAGGACAGCGCAGGC
TGCCCAGGGATTAGCGTGCGGGATGATCACAAACGGCTTGGTGCAATCCGGGTGTCGCAGTAGGGGAGTCGAAACGATCTTGCGTTTCAGAATCTCGAAC
GCttccttggccttgtccaAGTCACGTCCGGAACGCACTCGGTCCTCATCCAACTCGCAAAGCACAGCCGCAACTACAGGAAGGTCTtcgatgaacttgt
tgtAGTAATTCAGACTTCCCAGAAATGACTGGATGCCCTTCAGAGTCGACGGGAACGGCAGTTCCTGAAcgttcttggcgatcttcgGAGTGGCCTTTAT
TCCTTCGGCGCAGACTTCATGAGACAGGTACGGTATGGCCTGCTTACCAAACTCACTCTTCGGGAGACTGACCGAAATGTTCCAGTACCGGAGTCTGAAC
AGCAAAGCATTCAGATCCTCACAGAGTTGGTCCCAAGTAGGCGCCCCGTGAGCGATGTCATCGACATAGGAGCTGCGTCCCAGGACCGGCCCCATCTGCG
TCGGTGCTGGAATGTTGCGTCTGAACACCGTCATCTCACTTGCCAACACAGGAAGTCTGGAACCACTTTCACCACGACCATTCTCCACTGTCGTTTCAGA
GTCTGAAACGGGCAGTTCCAGAAACTCCAAGACATCCCGGTCaaccttggcctcctcctcaggTGGGAGTCGAACGAAACCCCAGAGACAATTGTTAATC
ACACTCTGGTATACCAATGGCGCGTTCTTGAGACCAAAAGGCATTCGGATCCACTGGAAATGTCCGAACGGACAGACGAAAGCCGAGATCAGCTTGGCAC
GCTCTGTCAGCAGAATCACCCAGAAACCACTCGCCATATCCAGACTCATAAACCACATTGCAGCTTCAAAATCGATCAGCAGGTCGTCAATCAGAGGTAG
AGGATATCGAGACAGCTTAATCAACTGATTGACCAGTCGATAGTCAATACACATTCTGATATCCACtccgttcttcttcaaaacGATCACGATCGGGGAA
GCCCACTCCGATTCAGAGTGTTCGATGAGTCCGGTCTCTAGGAgtttcttcagcaactcATAGACTTGCACCAAGTACCTGGGCGCGATCTGCCGAGCTC
GTTGTGCTATTGGTTTCGCATCTCCCACGTCCAAGTCACAAACGACTCCA