Description :
From Genome Similarity Track
Location :
Scaffold_156:124- 1659
Sequence
1535 bases(100 bases per row)
gcgtctccagtctcgcccacggatgcgtccggatcatcactgtcctcctctcccaggtacaaacgctgcacctgcttattcagagctttgtcatgctgtg
ccgttatcaccactcgatccttcggcaggtatacgcggtatcctttcgtccctttacctattccaacgatgatgccctgttaagcccgatgcgagaagtt
cttgcttttagtttctctaaacacggtgcaaggggagccaaacaccacgatcttacccaaagatggtgtccacttcttgagcatcttcaatggcgagacc
ctcccgggattcgactcagtcggtgacctattgaggatttaggctgcatactgtacagcgtcgtcccagaagctcaaatgcaaaccacacgcaaaaaatc
aaacagcgggccatgttcatcaccattcggttcattctttcagcattcccgttactagcttggttgttgacttcagtgcgttgccgagccacctcggcct
tcttacagaacacgtccacgttctggtattcgaccccagcgtcagtcccgaacacgtgaattctgcagtcgaatctcttttcaaagaacacgagaaagcg
tccgaacagcttcactgcctcgtccttggtctttcaaggaacacccgacggtaggtgcttttatgtcccccaaaattaatcgtgtagcggttccggagac
gatcgtgcggagtcatcggattttcaagtcagagcagatcaccactcccgctcgatggatcggcgaatgctcgccagtgtccttggcagactggctgccc
ttcgactgttttcctggcgcacaaggaggcagttgacacgtcgtctgttcgtcagttctatccccgcggtgggacccttcgccagacgctccactgcatc
gtagttcaagtgcccgatccttcggtaaaaaaatcaaccggagtccccttctgcacattcacaggtgtatctccagcgtgagccttctcgttcaatgctg
ccatgattaccggcgacacaggcccgtgcttcctcacaacattcccgtcgaccatcagcacattccgctccagccagacatcgaattctactcgtccatc
gacaacgaccacaactcgccgtccatcctttcgggtaagcgtacagcccttctcgtccaactgaccgtatgatattaagttgtacacgacgttctctgcg
tagaagacgtcatgacctccacagtctgctccgttccgcttgcagtgaccctcagcggcactgagcccttcattgtgactgccaacggctcgccgttcgg
ctgagtgcagcggccgtcgcgcgtctccgcgatctctagccacgtcacgtcgctcaccaagtgtctgctagaccactgtccagtatccaagtttctgtcg
actcgctcgccgactcactcaccgtcaaggtaaaacccggtgacgttttcttctccggacacgacgcacgtaaatggccgacctcaccacaaccgtggcg
tcttctggtctctgtgcgacgttctctcactgtat