Description :
From Genome Similarity Track
Location :
Scaffold_1150:124- 1187
Transcript NameFunction/comments
g15452.t1hypothetical protein

Sequence
1063 bases(100 bases per row)
TGCGTCGTCTCGTTCCAGGTCGGCAACTCGTCGCATTCGGCGAACACCACTGCGATGAGGTTAGAGATGGGGAATTTGAAGACGCAAATCTTGTACAACC
ACGTGTAGCCCGACGGGATCTTGTACGCTGGGGGGCTGAAGCCCACGAACATCATGAATATCGAGTTGAACAGAATGCCCGTGATCTGCGCCACCTCCTC
GCTCGGAGTTGCGAACACGAAGAATTGCGCCAAATAGACCATCATCAGCACCAGTAAGGAAGACTCGAGCCAGAAGACCACCGCTACCCAAAATCCGGTG
AAGCCCACCATGTAGTAGAAGATGGCGGTGAACAGAAGCGAGCTGACAAAGCAGTAGGGAATCTCTGCCAGCGTGGAGGCAACGAAGTACCAGAACGCGT
TGTACGTCTGGGACGCACGCTCGCGGTAGAATGATTCGCGCTCGGTGCAGGTCAACGGCATGACGCTCTGGAACACAGCCATCGAGTTGAACAGCGACGA
CATAAAGATCATGCCAACGCCCGAGTTCAAGCCTGAGTACGAAGCATAGTCGTCATTGCTGACAAAAATCAAGCCGAACAGAATCGCCAAGAAGAGGGCG
AGGTACATCCGCGTCAGGTTGTACGTTGGGGTTCGCCAGTACATCTGGAAGTAGCGGGTCACCACGAACTTCATCTGCGTCATGGAGTTGGCAGCACGTT
TCTTGCCAAAGACCATTTCTGGGAGATCAGGAGACGGAGTTGTGATGCCTTCCTTGGCCATCGTAGTTTCCAGCTTCTGGTTGTACGGGCTGTTCTTGAA
GTAGCTCACGAAATCCATCGAGTCCTCACTTCCATGACCCACACCTGCACCAATGCACTCCAGCATCCACGTAGCTGGGTTGTAGCCCTTCGGCAGCGGA
GATACACCAGGGATGTTCTCAAAGTAGTCGATCAAGTTGCGGCAGTTCTCGCCCAAGTCGCCGTAGAACGCAGTCTCGCCACCGCGCTGCAACAGAAGCA
GTCTGTCGAACAGGTAAAACACTTCAGCCGACGGCTGGTGGATCGTACAGATAATGGTACGGC