Description :
From Genome Similarity Track
Location :
Scaffold_118:12399- 13472
Transcript NameFunction/comments
Albla_Nc14074330myosinlike protein putative

Sequence
1073 bases(100 bases per row)
AGCAGGGCACCACCACTGAAAGTCAATCGATCCTCGTGAGCGGTGAGTCTGGCGCCGGAAAAACGGAATCCACGAAATTCATCATGGAGTATTTGGCCAC
ACTATCCAAATCCCAAAAGGGAAGAATGACGGAGCAGGAGACCAGTGTCATTGAGAAAATACTGTCTTCAAATCCCATTTTGGAATCCTTTGGGAACGCT
CGTACCATTCGTAATGACAATAGCTCGCGATTTGGGAAATTCATCAAATTGCATTTTTCTGTCGCTGGCCAATTGATCGGTGCATCGATTCAGACATATC
TATTGGAGAAGGTTCGGTTGGCATATCAAGCGGAAACCGAACGCAATTACCACATCTTCTATGAATTGCTGGCTGGATCCAGTTCTGAAGAAAAGAAGCG
TTGGTATCTTCCATCGAATTCGAGTGAGTTGCATTATTTGAATCAAAGTACGTGCAATAAACGAAAAGATGGAATTGATGATCGAATACAGTTTTCCAAT
TTGAAGAAAGCAATGCACGTGATGGGCTTCTTGCCGACTGAAATTGACGCCATCTTGAGTACAATCGCTATGCTTTTGCATTTGGGGAATTTGACATTCG
ATAAAGTTGTGAATGATGAGTCTGGAATGGATGGGTCCAAGATTCACGCACACACAAAATCGCTGCAATTTGTGTCCAATTACTTTGAAGTCGATCGTTT
GGGATTGGAGCAGTTGCTTTGTTTCCGTAAAATTAAAGCCAAGGATGATACATATGTGATCAACCAGAGTGTGGAAGACGCTGGGAACACACGAGACGCA
ATGGCGCGTTATATCTACGGCCAGTTGTTCGACTGGCTTGTGGATCGAATCAATAGAAGAGTCGAGTGCGAATATGAGACGGAGAAACATTTCATCGGCT
TGCTGGATATATTTGGCTTTGAAGACTTGAGTCACAATTCCTTCGAACAGCTTTGTATCAATTATGCCAATGAAAGACTTCAGCAGCACTTCAATCGAAC
AGTTCTTCGTCTCGAGCAAGAAATGTACGAACGTGAAGCGATCGAATGGAGCTTCATCAACTTTCCAGATAAC