Description :
From Genome Similarity Track
Location :
Scaffold_15:123989- 126490
Transcript NameFunction/comments
Physo_567881phosphatidylinositol kinase (PIK-G2)
Physo_321562Hypothetical protein

Sequence
2501 bases(100 bases per row)
GCGACATCAACGGCGCAAGACTGGGACTGTGTCGCCTTCATCGTCAAGTCCAATGATGATCTTCGGCAAGAGGTGCTGTGTCAGCAGATTATCCGCCAGC
TGCAAGATATCTTCCATAGCGCAGACTTGCCTCTTCGACTTTTGCCGTACGAGATCATTGCAACTTCAGCGTCTACTGGTATGATCGAGTATGTCAAGAA
TGCCGTGTCGCTTGATGCCCTAAAAGCGAGGGATAACTACACGACTCTGGCGGATCACTTTTTGAAAACGTATGGCCAAGCGGATTCCGCGGCTTACAAG
ACGGCTATGACGAACTTCGTGAGGAGCATGGCTGCTTACTCTTTGGCGTGCTACTTCCTGCAAATCAAGGACAGGCACAACGGCAATATCATGATCGACA
GCGACGGTCACGTGATCCATATTGACTTTGGATTCATCCTTGGCATCGCCCCAGGTGGCAGGTTCAGCTTGGAGACGGCACCGTTCAAGCTCACAGGCGA
GATGGTCGACGCAATGGGCGGGACGCAGTCGGATTACTTCAAGGCGTACGTCATTTTCCTCATCCAAGGCTTTTTGGCTCTTCAGGTACGGACATGCAGA
CATATTATATGCGCTGGTGGTGTTGTGCTGATCGTGTGATCTGTAATGTTATTGTTATGTAGCAACATGCCGATACGATCCTGATGATGATCGCCATCAT
GGCGCAGGAGTCGTCTTGCCCGTGCTTCTTGTCCCAGAACCCGAGAGACATTCTGAGTAACACGAAGCAGCTCTTCCGCCTCGAGTACAACCAAAGCCAG
GTCATCAAGCACGTGATCAGCCTTGTCCGACGCAGCCACAACAGCTACCGAACTCGTCAGTACGACGTCTTCCAACGAATGACCAATGGCATTTTACCCT
AAGGGTGATAATACAAGAATTAGACTGCTGAAGTTGCCAAGACAGTGGAGGCGGAGTTAGTGCTCGTAATTTTCGTGCCTTGTCCTCCGCAAACGTCACC
AATGACTCGCCCATTGACAGCGACGACCAAAACTAAACTAGAAATCACACTCAAATCTCGTACCAAACGCTCGTTTAGGCTGGGATTAACACGACACAAG
TACTTTGTAGTACGACATGAGTGGCAAACAAAAATCAGAACAAGAAGATATATGAACAGCTCGGCTCGCAAAAACCACGATTCGAGTGGCTGCCATTCAT
TCCCATGTCTGCTCTACTCCGGCTTCACCTTCTTCGGGCGACGGCGCACGGCAGTTTTCGTCTTGGCCTTCTTGGGGGACGAAAACGGGTTCTTGGACGA
TTTTTTCAGCTTCACCACCGGCATGCTACTAAGTGAGAAGCGATTCCGCGACAGCGCCGGCAACAGCACGCTGTTGGACTCTTGAGCTGTAAAGTGTCGA
CGAGTTAGTTAATAAACAGTGTGCATTCAGAGAAATAATAGCCTCAACGTACTCTTTTGGGTAAGTTCTGAAGACGGCATGTCTTGAGACTCGGTGTCTT
GCGAGGATTCTACGACGGAATCGTCGCTCGTGACAACAGAAGTCTTGGACTTCTTCACCTTCTTGACAACTACGGACGGCACCTCTTCTTCATCGGTATC
TGCACGACAATCCAGACATGTGAGCTCATGGATCTATTGGGATTCAGGTAATGGGGTTGCCTCCTAACCGTTCTTGGTCAAGTCTGCCAGAAGGCTCTGC
GAGTAATCCAGCTCTTCCTCATCCGACGACGAAGAGGACGAGCTACTTTCAACTGGGGCGACGTTCTTGGGTGAGCGCTTGGTTGGCTTCACAACAACCG
CCGCAGGTGCTTGATCGGAGTCAGAAGACGATTCGCTGGCTGTGCTCTCGGAAGAATTCACGGTCTCGGCTTTGGCGGTCGGAGAAACCTTCTCAGCTTT
AGCCTTTTTCTCGTTCTCGATGGTCGTCACCTTCGCTGCCAAGGCCGACTGGAATTTCAGCTTGGCAGTTTCCTTCGGGGATTCTTTCACCTTAGCAGGA
ACTTTAGCAGCAGGAGTCTCGGGCATTTCAGCATCTTCGCCGGAGGCTTCGTCTCCCTGAGTCGATGAGCCAGAAGAGCTGGAACTTGTGCTAGGCTTAG
CCTCAGCAACCACCGGGGTTTCGACCTGCTTTGCAGGCTTCGCTTTCTTCGGCGCTGCGGTCTTAGGCGATGCCTCCTTCTTTGCACGCTTTGTCGCCGG
TTTCTCAACGTCGTCAGTCTCGGTGTCGATTTTCTTCTTGGGCTTGCGACTCACGGGAGTCGACTCGCTAGCAGTCGACGAGTCATCCGCCTGATTAATC
AGCGACTTGGCGGCAGCCTTCTTCTTCACGGTCTTCGTCTTCGGTTCGGCTTGTTCCACCGCCTTCTCAGCCTTGGTTGCCTTCTTTTTTGCTGGTTTTT
CGGCCTTGGTTTTCACTTGCTTAACCTCGGCAGATTTCGAAGACTCGGCTTGCTTGGCTTCCGCCTTCGAAGAGGTCTTCTTCTTCTTCGCTGGCGGCTC
C