Description :
From Genome Similarity Track
Location :
Scaffold_151:12398- 18281
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_151-snap-gene-0.21Anaphase-promoting complex subunit
Pytul_var.sporangiiferummaker-pug3_contig_151-snap-gene-0.22Gene of unknown function
Pytul_var.sporangiiferumsnap_masked-pug3_contig_151-abinit-gene-0.41Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_151-snap-gene-0.24Gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_151-fgenesh-gene-0.10Conserved gene of unknown function
Pytul_var.sporangiiferumsnap_masked-pug3_contig_151-abinit-gene-0.34Regulator of chromosome condensation (RCC1)

Sequence
5883 bases(100 bases per row)
TGGCTTGTTCGCGTCGATTGGCGCGACGGCAGATGCGGCCCATCAGGTAGAGCCCCGCAGCGCCGCATGGGATCTCTTCCTTCGCTGTCGCGTCCACGAA
GTGCCAGTCGCCTTCGCCGCGCAGCGCGTTCTCTGCTTCCACGAGCTTGTCCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNTTTCGCGTTCGCGAGCACTGCGATCGCTTGGTTCACGCGGTTGGCGCGGTGATAGCACGTCGCCAGNNNNNNNNN
NCAGAGATTGTCCTCCGAGCGATGCTGATGAGCGCATACATACACATACATAATGCATCAACATGGTTGCATATACACATAGCAGCAGTAATAGCAATCG
CACAGGCTACGTACATGTGCCACGAGCCGTTCGGCGAGAAAGACCGCGTTCGTGTATATGCAAGTGGCCAAGTAATGCTGCACTTTTTCCACGAGCGTTG
TCTCCAGCGCGTCGATCCCCTTACTCTCTGCATGTCGCGCGAACGCGTCTGCGGATGAAGATGCGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNTGCCACCTCAGCAGTAGCGCGGCAGGATCAATAGACAGAGAGAGAGATACACTGACACACCCACGACGCTTTCGCTGCAAGATGCT
GCCAAAACACGGTCAAAATGGCGAAACCTCTGTTCGCGCAACCTTCGTGGCACCTTTCGCGCCGTTTTAAAAGGTTGCTTCCTTTTGTTGCCAATTACCT
ACTAAATTGAATAAACAGAACATTTTGTATCATTCAGTACTGGATCAAAGCGCTTTTGGCTCTAAAATTGTGCGCTTACCACCTTTAAAATACATATTGG
ATCAAACAGACAATCTATGTGTGGTGACGCATACAAGAGGTATGACGGAGCAACAAAACGCAGAGTTTCCAAAATGGCTCCATGAGATGCATTTTACACG
AGCACTTTGACTTGGAACAAGCTCCTTGACAGCTCCGGCTCCTCTTCCTTCTGCTCGTCTTCCTCGTCGTTCTCATGATCACGACGAGACCTGCGCTGGG
GGAGGCGGTAGGCTGGTGACAACGACTGACTGCCTCGTTGCGCACTGTTGCCGCTCGCTTTCTCGTTTCGCTCGTGGCGTCGTCGCCTCGACTCGTGTCT
GCGTCTTGCTGGCAATTTCTCCATCATGGCTGCTGCATCAGTAGCCTTTCGCTCCGCCTTCGACCGCTCGTTGGTAGTGACGCGGTGTGGCGAGAGCGCT
TTGAGCTCCTTCTCAATGTTGTAGAACCCGCGGCTCTTGATGACGCGGCTGTTGCGGAGCATGTTGTTTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
CTTGTGCCGCGCTCACTAGCGTCTTTGCCTCGTCGAGGCGACACTGTCTCAGTGATGCGCGGTGGACTTCCTCCTTGTCCTGCTCTTGCTGTTCTCGCGT
CTTGTGCTTCGATTTCGTCAGGACTCAGCGACACAAACACGCTTTCGCCTGCAAGCGACTGGTCGAGTGAATTCGCAGTGGATGGCAAAGCCTCCTCTTC
ATGCTGTGTCGCTGTTGTAGCACGAAAGCCCCGGAATTGCGATAGACGCTTGATACGCGGCGAGTCCATCACATTTGGTGTCAGTCGGTTCTGCGGAGTC
ACTGCCATGAAATCGTCCATGGAGATCGGACTCGGCTTGGGCTGCTCACGAATGGGGGTGCGAGGCACATCGCGTCCCAGGCCAAGCGCTGCGAATGACC
GCTCCATCTGGTGCATCTGCATTGAACGCTCGAACCCTTGCGGCGATCGCTGTGGAGTGGAGAGCGACGGCGTGTTGTACTCACGCAAGGGACTCGGCAG
CATGACGTTGTCACCACTCGAGTGCGGACGGAAGCTTCGTTGCGACTGCTCCTCGTTTCGCCATCGCCGCTGCGTCTCCAAGAACGTCGCCATCTTTTCA
TTCTCGAGCTGCAGGAGCGCGCGTTCTAGACGCAATTCCTCTTTCTCCTTGCGCAATTCTTCTTTCTCCTGGCGCAATTCGTCCCGCTCGCGTCGGATAT
CGGCCAAGAGCGAGCGGTATTCGCTGATGAGATGGCTGCGGGACTCGGTAAATACGTCGTACGATTGAGTAGGTTGTTGTTGTTGTTGTACCTCACGGTT
CGCATTCATTGATGGCATTGAAGAATAGCTGGGGCGAAACGGAGCTGGCGGTGGCATTGGCGCGCCATTGTCGTCGGGAGTAGTGTAATAGTTCTTGTGG
TACTTGTTTCGCTGGGGCTCATTGAATACGTACCCATCCTCAGTCAGTATGGGTGGCTCAAAACGTTGGCGGTAGTCAGAGTGCTCCTGGTCATGCGGTG
AATCAGATGTTGGTTCATACTGTTGCTGAGATGGCGGGGAATGCTGCATTGTGTAAATACTGGATTGCGGCTGGGAGGCTGTTGGTGGTATGTGGTATCC
GAGCCTCCGCTGCGCTCGCAACTGCTGATCGCGTAGAAACATTGTTTCCTCCTGCGCCGCCTCCCGCTCGCTGCGTTTTTGCTCTTCTTCTTCCTNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGCTTGATGCGCGCCTTCTCGCGTATCTGCTCGTCCAGGATGCGCTTCCACTCCATCTGCTGCGCGCGTN
NNNNNNNNNNNAGGTCCGTGATGCGGAAGCGCGTGTGCGCATTCGCATGATCTCTATCGATACTTGGTGATCCGCTGGGTTGCCCGGTTGCTGCTGACGC
TTGCACTCCAGAAGTCGACGTGGATGACGGGCGGCGAGACGGTGTTGATGAAGTCGCCGGTCGCTCAAACAAAGAGCTGTTCATCTGGGACCACGGCGAG
GGTTGCTGCTGCTGGAACCGCGACGGCGAGCGGTAGCCGTTGTTGTTGTTGTAATAGTCTGCGCGCTGCATGTCCAGTCTCGGCGTGTAGCCTCCCTCAA
TGAGCCATTTCGCGGNNNNNNNNNNNNNNNNNNNNNNCGAGTGGTCGTCGGGTTGGAACTTGCGCTCGAGCGCCTCTTGCTCCTGCTGCTGCTCGCGCTG
GATGGNNNNNNNNNNGCGCAACTCGATCTGCAGCTCTAGGTCCTTCGCGTACTCGAGCTGCTTCTGTCGCTCGGCGCCGGCGTCGACCACGGCGTCGGGC
CAGATCATGGCTCCTTCTCCCTTTCTTCCGCCTTTTTCAGTCTTCGAATTCAAGGGAAATAAATGAACATGGACAGATACGATGTGCGAGGGAAAGCTGC
CGATTGGCTGAAAACAACAAATGGTAGAATTTGTTTGGCTGTTTCTCGTTTAAATATCAATTCAGCGCATTCTGATTGGTCATATTTCATTTGAATGCTG
CTTGTGTGCTTCAAAAAACAAATTAGTGAAAAAAGTCCTTGGTACATGGAGATGAACGCGCACTGCCAAGAACCTCACAGAAGATGGAGCATTTGCTCCC
ATGGTATCGCTCGCCTTCTCGCTTTATCTTGTCTACTGGAACGTGCTCGTGCTGGCGAATAAATAGTTGTCAGTGTACTCGCGGCGCAGATCGGCGAGTT
GCCGCTCGATCTGCATCTCATATCGCGTGTTCTCCGACTGCAGCAACTGGAACCGCAGCGCGAGTTCACTCTGATACTGCTCCAATTGGCGGCACTGGGA
CTTGAGCTTGCGCTGACTGCTTTTGCTGCGCCCTCTCTCGCTGTGGCTCTTGTCGTTTTTCTTGCGCGCACTGCGCAGTATCCGCTGCACACGCTTGTGC
TCGCGCGTGCGGTACTTGTACTCCTTGGCCATCACTTTGAGCGCCTTGTACTCCTTCTGGAGGTGCTCCACCAACTCGCTTTCGCGTTGGAACGCCTGCT
CCTGTTCGTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCGGCCTCGGTCACCAACTGTACCATCGTCTCTTGGATCGTCGCGTCGTCCAC
AACATGCGGCGTCATGTGCATATCGCTACTACCGAGCGCAGCGGGCGTCGAAGGTCGCGTGTTATTGCTAGTATATGCGGTCGCGTCATCGCCTTCATCG
ATCTCTTCGATGTTATTCAAGCCATTCGCATCATGCTCTTGGTAATCATCCTCCACCTTCACAATCCGATCACCAGTCGCACGGTCATCCTCCTCCTCCT
CCTCATCATCATCGTTGTCGCTACTGGCACTTCCATGGGACTTACGGCGCACCGCCATCTTCACGACGACGCGCTTCTCGCTGCGGATGCTTGCGTCGCC
TCCGCCGTCGCCATTCGCACCGCGACGGCGGCTGCGACTGCGCTCGCGCACATGCATCTCGCTGATCGTGTGGGTCGTCGTCACGACGTCGCCACTGTCG
CTGCTGTGGCCGCCACGAGACCGGTTGCGCAGCCGCATGGCGCCGTTCAAGCCACCGCCGTATGGCGCGATCTCGTTCGGGTTCGCGTCCGAGTCGGTGN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGCCCCCACTCCTTCCCATTGTCAAGTTGCTTTTTTTTATTATTTTTCTACTGTTCGTTCGCCT
CGCTCAAGTTCAAACGCTCGAATGCAGATCACAAATCCCTGCTAGATAGCATACCCCCTCCTAGTCGATATGTTGAACTTACAAAGCAGCATACTGTGCA
GTGTGCAATCACCTAAATCAGTTTATTTGTATTAGAAATCGAGAGATGTTAACGAGCTGAGTGTGCTATTTTAACACAATGTAGTACATTATCATGCAAG
CTTTCGATGTTTCTGGGGTTTACCTTGCTACTATTGGATTTCTCGTGTCTATCGATCACATGAGACTCGTGTCATACAAGATGCACCGAATCGAAAGGAG
ACGTTGATGAGCTCCCGCTTCCTGCATTTAGAGAGATTGGTGAGGGACCTCTTGCGTGCTTGAGAGTGGCGTGAGCAGCGGTGAGAGGATGCCGCGCGAC
GAGTGCAACAACGCCACCGAGTGCGCGCCGCCGGCAGACACTTGGCGCACTGGAAGGGAGCCCAAGTGGAGTGGCTGTGGTACCAAGATCGTCTTCATGT
CCACGACTCCAAGGCGACCGTGGCTAATAGTCAGGCGCAATAGTGCCAATATAACGCATCCATTAGACACTGCATACCAATAGAGCATTTCAAAAGGTCA
AGATACATACTCGGCTCTTCCGGAGCTGTATGCGACGCCGTCTTTCGTGAGAAAGAGCGTGTGCGAGCCGCCGCACGCAGCCTGAACGACAACCTTGTCC
TTGAGCGCTTCCACCTGCGCGCATACAAGCGCACCCACATCGACACATTCAATGGTAAGAACGGAGGTTTATAGCGCAACGTTGAATGAGGAAGAGAGGC
CAACCAACCTTTTGAGGCTTGTAGCGACTTCTCGTGTCGCCAAGACCCAGACGNNNNNNNNNNNNNNNNNNNNNNNNNNCGTACTCGCCACGCCCAAACG
AGTAGCAATCGCCAGCCTTGGTCACCACGACCGTGTGCCACCCACCGCACGACACGCGCCTGTCAGAGAATAAACAACCATTAGAGAACGAGATGGAGTC
AACAATCAGCACGAAAGCACACGTACAACGCAGGCATTGTCTCGAAAAGCTCGATCTTCTGTGGCACTTGGATGTCCGAGGTCTGGCCGACGCCGAGCAT
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCG
ACTTGAACTACTTTTTCGTCTCCAAAGCCTTCAACGCGGTGTGGGCGACTCACGCCCAGCAGCCCTTCGCAATCGGAATCGTG