Description :
From Genome Similarity Track
Location :
contig_5:123963- 127343
Transcript NameFunction/comments
g1314.t1hypothetical protein

Sequence
3380 bases(100 bases per row)
ATGAAGCGACGGAGCAGTTCGGTGCGAGACGATGGCGGCGCGGAGCAAGAGCGGGGCGCGCACCTTCAACTCGCACAGCGCCACCGCAAGATCGTCGCCG
GGAGCTTCAAGGGCCACTCCGCGCTGGAGCCCGAGTTCGCCACGCCCGGCGTGGTCGGCAAGTTCGCGCTGCGCTTTACGACCACCGGACCGCTGGCGAA
GCACGCACGAATCACCTGCCATTGCCGGACCACGGCTGGACGCTACCCACTGCGTCGCCGCCGACTGTCGTGCTGCAACTGCCGTCCCGAATGAGCAGGC
GACTACCGCCGCGCTGCCGCTGGTGAAGATGAACTGGAGTGCTGCGACTAGAACGATGGAGTTTACGCTGCTGAACGAGAGCGTGATCCCGCGGACACGC
CCTTGGTTCTGGTGGTGTCGGGCGTGGGGACCCCGGAGAAGGCGACGCCGCAGAGCGAAGCTGTCGTCACGACCTTCGAGAAACTCGTGGCGAGAAGCAC
CGTGCCGGCTTCCACACGCGGTGGACAGATCATTGATGGGCCTGCTGCCTTTGCAATTCCGAAAATCGTGCCGGGGTCGATTGGTGGGGCGAAGCGCTGG
AGCCCGTCCAATTGCTGTCCGGGGGTAGTCTCCGACGTGACGCTGGCGTTTACTGTCAATGGCAAGGTTCCTGCGGGCGGGAAGCTGCTCGTGGAGCTGC
CACCTGACGGCTGGGATATGGACGGCCAGCCCAAGGTGCTGCTTCGTACGCCAGTGTATCACAACAAGGTCCTCACCGCTTCCTGGGATTGCAATCAGCA
CACCCTAGAGATTTACCTAGGCAATGATGGGGCGTCTATTGCTACCAAGACAAATGTGATCCTGACGGTCGCACAGGTGAAGAATCCAAAGAAAGAGACA
ATGATTTTGTCCGTGTCAAGTGCATCGAGTGAGACGCGAGCTGCTGCTCGACTTACCACGCTGTCAGCGAGTGGTGGCGTGATTGATGGCCCCAACAAAG
TGGACGTGGCGCGAATTAGTGAGCTCCGAGAACGGGACTTTGAGGTCCTCACAAAAGTGCTTGACGCCGATGCAGCAGAAAACACTGAGGATGGCATTTC
CATTGCCAGAGTTCCAGCTGTCTTGCGCCGAGCAGGTTTGACGCTCTCGGACGAGCTGTTTCAGTCGCTTGTGGCTCCTTGTTTTCCAGTGCGAGAGGAC
CCTCCCAGAGGTGAATCGGAAACAACGAAACGTCGCTGGTTAATACACCACTCGCTGCTACAGTAACACCGACCACACCGGCAGACGATTATCTCTCTCA
GAGAAGAGTTACTCAATGTGTTCGCTCTGGTCTACGCCCCGGCGTACAAATACGGCCAGGAGCTCCGTCTAGCATGTGGTCGAGGACATGTGAATCTCGT
ACGAGAGTGGATAAGTCGCGGCTGCAACCCAAATGCTGGGACGCTTCAGGTTGGTCATCGTTGCACTACGCCGCCGACTTCGGCCAACTCGAGGTGATCA
ATCTGCTCGTCGAGATGTCTACGCCACCTCCAGAGAACGAGTCCATTGGCGAAAACAAATTTTGCACGCTGGAGATCATGCCCGCGATGGCCACGACTGG
ACCCCACTCATGTGTGCGGCAGCGAATGGCCACGTCGACGTCGTCCAGAGGCTGCTGGCGCTTGGCGCGAGCGTTACACAGACCAGTGCTGAGCACCTCG
GCTCTGCACTGGGCAGCAAGTCGTGGATTGGCCGCAGTAGTCTCCGCTCTGCTTGCCGCTGGCGCAGACGTGCACCAAGCGGATCGATGCGGCTGGACGC
CCCTGCACTGCGCGACACTGCACGGCACACGAGCTGTGCGGCGCTTCTCGTCGAGAAAGGCGCCGATTCGTCGGCTCGAGATAAACTCGAGTACACACCC
ACTTTCTTCGGCGATGCCACCTTCCTCCTTGCGCCGGCAGGCCCGTAGCAGCAATAACTGTACCAAATCCACGCGACCTTTGTCTCGTCCGAGTCCAAGC
AACTGCAGCTTCAAGTCAATGCACTCGAGTTCGCCAGTGCAATCTAACTGTGACGCCCTCCACCTCCTGCAGCACCTGGTGGAGCGTAGGGACTCCTTGC
ATTTCTTGCATTTCTTGCATCCGAGGATATAGACAACTTTCGTACTTACTCGAAGACCGCCGTTGCGCAAGCACCAACTTGATCCACTAAAGCCCAGGAG
CTCCTCACGCTCATTTTCCCAGTCTCGGAGCCATGGCCACATCTGCAGGAGCCAAAGTGCTGGCTGAGGTGTACCGCCTGCACCACATCCCGCTGCGCCT
ATTACGCTGCAGGCGCTACTCAAGCGAGGGCCCCGTGCCAGCCCCGCCATCACTGCGTCGCTGCAGAACGATCCGCAGGCGCTGTCCAAGTGGCGCGAGG
TGAACGCGCCCGCCATCGTCACATCCGCGCAGCTGCTGCATCGCGAGGCACCATCCGCATCGCGCGCCGCATCGTGGACCTCGAGAACCTGCCGGACGAG
CTGCCAGGCGCGCAGCCCATCGTGTCTCTGCGCGAGCAGCTGCTCAACAGCTTCGAGCAGCTCACGAGCTGCCCGCTGCCGGCTAACCTCGCGGGCGAGA
GGGACTTCGTGGAGCTGCACCTCAAGATCCGCAAGGAGCACGCCACTATGCACGGCAACATCGCCGAGGCCGTACAGGCGCTCGAGTACGAGCCGCAGGG
ACTCAGCGAGTCGCTCGACAACTTTTACAACTCACGCATTGGCATCCGCATGCTCGTGGACCAGCACGTTGCCGCGCAGAGCCCGACGCCGGGCTTCACG
GGCATTGTCAGCGACGAGTGTTCGCCCGTGCAGATCGCGCAGGACATTGTGCACAAGGTGCGGCCGCTGTGGCAGGAGAGCCTCCACGGCGACCAACTGC
CTGCAATCGTTGTGAATGGGGAGGTGGATGCTACCTACCGCTATATCCCGCAGCACATTGAGATCATCTTGACCGAGGTGTTCAAGAACGCGGTGATTAA
CAGTGTCGCTGCGACCAAGAGGACGGGAACCACCACCCCGCCGCCTGTCACGGTGCTGATTTCGGGTGGGCCGCACGGCGTGTGCGTCAAGGTGTCGGAC
CTTGGCGGCGGCATGACTCGCAAGGAAGCCAATGCGTTGTCGAACTACTACCACACTGCGACGTCGCCGCCCTCGAGCGGATACGACCCCGTTGCGGATG
TGTTGGAGAGGCGTGCTAGCGGACTGGACTTCTCAGACTCGTTCGGTCTGCGCATTGCTCAGCTCTACGCCAAATACTTTGGCGGCGAGTTGGCGATCAT
GCCTATGGAAGGTCACGGTGTGGACACGTATATTTACATGAACTGCCTCACCGGCGCCTCTGAGCTCAAGTAAGAAAAGT