Description :
From Genome Similarity Track
Location :
Scaffold_332:12396- 17004
Transcript NameFunction/comments
Phypl_g7079hypothetical protein

Sequence
4608 bases(100 bases per row)
TTAGATGCGAAGCTGGTCGGTCGGGCTGATGCCTGTCCAGCCTGTCATCTCCGTGTCTGCGAGGCGGAAGTCTCCATCCATTTCCACGCAGTTGCGCACG
GCGTAGAGCAGTCGTTCGCGGCAGATTTCGTCTGTCGAGTAGCgtgggagctgcagcgcgaagaaaCACGTGTGCGACTTGGGCATCTGCGAGTCCATCC
ACCCTCCAGCGCTAGCTGTCGCtccggacgaggagctgttGCCATCTCCAGACCCGGTGGACGCAAGAGCTTGGATCTTGAACTTCTGGTGGAACTGCGC
CGAGCCCAACGGCAGACGCGACCGCGCCCACACAAAGCGCAGGAACGCGCGCTTGTCTTCGGCCTCGAGGCCTTCCAGCACCCGCCAGAACCGctggatg
aagtcgtcgctcggtgccagctcctcgtcgtactcggtGTTGGCCTGCAGGAGCTTCACGTCCACTTCTGCCACGCCGCACATtcgcttctcgagctccg
tccacgtcagcagcgccaaagCCGACACGGGCATGATCGAGTGCAGTCCCTGCTTGACGATGTTCAGCACTTGCTCCGTTTCACCCACACGCGCTCCAAG
CATCGCGTCTAGGTACTGCGCCAGGTTGCTTCGGGTCACGGCGGTGTTGGTGCCATCTTCGCACAGCTCGACCGTCCTCCCATCCGACAGAACCGTCGTG
AAGACCAAGTCCAtggcctcgagctgctcctccagctcgcgttgCTTGGTCCCCGTGGTGGCAGCATCCGGTCCGGTCTCgagccgcttgagctcgtccg
aAAAGCCTTTGAGCGTCTTCCACAGCGAGTACGCGACGAAATCGATCTCTCGCATGGTCTCGAGCGCGGTCTCCGGGGCCGAGGCCTCttccgccacgag
ctgcttccaCACCGACATAGCCAAGTCGAGACGGACGCACACGCGAGTGCGAAGACAGATGCCTATCATCTGGCCGAGGAAGAAAAACATCTCGCAGTAG
AGCTGGCGTTTCTCTTCTCCGCTTTCTCCTCGCAGCGTGGGGGTGTCACCAACTTCTGGACGGGCGATGAGCGCTCCGTTAAGCACAAACTTCTCACGGT
TCGCCCCGACGCCGTTTCTCCAGTTCGGACTTggcagcaggaacggcagGACGCACGCCGACACGGACACCCCGGGGTCCAAGTGCAttgacgtgctgct
cggtcCTCCGTTGGCAGAGTGATCCGAACCTGTGTTCGCGTTGTCCTCTCCGGACTCTGGTacctgcagcatctgcaatTCAGCGAAGAACTGCGAGAAG
AACTCTCGGTACGGGCCCCCGTAGTCGTCCACACCTTCACCCTCGAACTTGACCTTGAAGCTTCGCAGTTGGCCGTCGTCCATTGGGTGCGAGTAGACca
tgcgcagcgtcttgagcggCAGGAAGTGGAGCTCTTCGAACGCCTGGCCGAAGAGCGACAGGAAGAGGCTGCTCACGCTCCCCTCATGGCACTTCGCCGC
GGCAGCTTTCAAGCGGTTCACCTGGAGTTGCGGCAGGTCTTCCGGGTAAtcgtactcgtcgtccgctCTCTTGGGTGCGTTCGCTGTTTTGTCCATCAGA
GCCGTCCAGAGCGCGTTCTTCACGCAGATGAAAAGGCTGCCACGGCATTCGGACACCAGCCGACAGGGCAGCGAGCTCGACGCTGGCAAGAAATAGTGCC
ACGTAAGGTCGAAAAACGGCAACGCGCGACTCACGTACATGTtgcagaagcgcagcagcgcaaagcGTGCGACtgccatcttctccagctcctcccGAGG
CATCGCGAGCACGCTAGCCACGTTCGTGAGCTCCAAAACGCTCGTCTTGTCCTCGATgagagcgagaagctggcTCGGCGTCACATTCCACGGACTAAGT
CGCGACACCTCACAGAAATCGTTGAGCACGCTCAACAGCTCGCGATCAACGGCAACGCTCCACAGGGCGTGCTCCCCGTactcgacgagctcttccagcg
aCAGCGTAAAGGGTACGGACGGAGCTTCTACGCGGTCACTGCTCGAGTCCTTCCGTGAGCTCGAAAGGGTCGAGTTGGACTGCGCTGTACCAGTCTCAAC
CGGAGGAATCGGCAAAGAGgtcgtcgctgagcttgccATCGTTACCAAACGCAGCTTGGACGGGTGGACGAACCACGCTCCAGGTTCATTGTCCACCTCC
ACCCACACGCGTCCAcccgcagcgccgacgacaaggccatcTCCTCGAGGTGTCCGAACGCGGTCCTCGCAGTGGAAGCCAAGCGCCCCGCAAGTCGTGC
TCGTGACGTCCACCCACAACGACTTCCCCGACCGCGTCGTAACAAAGCGCGTCGACCCGGCGAGCCATTCGGAGGTCAGTTTGAACGCTGCGGCACACAA
CGCAGCGCGCAGGGGCTTGCGTGCCACCCAGTTGGCCATGAGTTCGCAAGCGACCACGCAGTCCTCGACGCTTGCGCTTTCATCTTCGCCGATCCGGggc
tcgctggtgccgctggagctcacaCAACTGTCCACGGCAAACGAGATTTTCTGCTGTCTCGAGTAAAACGCGACCGCGGGGCACACTTCTCCGACGACGT
TGTCAAACGCCAGGCCCAAGTCCACGCCATTCTTGCTGAACGAGAGCTCGCCTTTCTCGCAATCCAAGCGCACGCCGATGCAGTCGCCTTCCGTGAACGG
CTCGCCGTACGCTCGCACCCGGTTGCGCTGGTAGTAGAGTGCCTTGTCGCCGATGAACCCCCAGGACTGGTTGTCAGCGCCGAGGAACGAATCCAGGTTT
GCTTGTCGAGTGGCGACGCCTACGAACAGGTAGGGCGAGCTGGACTTATCAATGCGAACGACCCAGGAATGAATCCCCGTGGAGAAGCCCACGACGGCGC
ACGCGGCTTTCCAAACCTCATTCCCAGAGTACGACACGCTGAGGCCATCGTCCGCAAACGCCAGTAAGCTACTGCGGCTTCGTTTCCGGTCGAAGTGCAG
CGAGGAACCGTCCGGTTTCGGATCACTGGGCGTCGTTGGAGGTAGAAGAGATGATACCAAAGATTGAGGCCTGCACTCGCCACCTCTGCCACTAGAGATG
AAAGATGAGGTATCGGTAGGATTCCGGGCCACGCTCAAGTCGCTAAAACCTGAATAGCCCTGCAAAAGGTGAACAAGTTCCACGTAGCCCTGGAGGTACT
GCGAGAACAGCAGCCGGCCCTGCATCACCTCGCGACTGTGTCGTAcgcttgcagcagctacgaACTCTCGGACAACCAGTTGCGACTCGATCACCGCGTC
TTTGGCTTGAGTTCCCGTGACGACCAGCAGTCGACTGATGGTCCGCAGTGCCACAAACTTGAGTGGCAAATTGGTCGTGCCAAGGCAGCATCGTAGCCGA
CGCAGGACGCTCTTCACCAACTCGGCAGGAAGACacaagcacgagctggtgggGCCAGCTAGTAGCACATCTAGCAGCCAAACGACGACTTCGATTCCGG
GTTCCTCCGCCACGGTCTTGTCCGGTCGCTGGAGATCGCGTTGCGTCCACAAAACAGCTTCAAAACGCTTgcccgccgctgccgcttccaGTTCATCAAG
ACAAAACGCCAACGATGCCGTCGCAACGGAAGTCGCGTCGCGGTCGaccaagcagctcatcgcCTTTGCAAAGACTTCGTCAACGGAGAACGCCTGGAGG
CGTGGGGTTTTCGTCGTGTTGTCCGTTCTCGAAACGATTGCGAATTGATCGCCGCGCAGCAAAAccaacttgagcagctggagccACTGTGCGTACGAAA
TGCTTAAGCGCGGGGCCGAATCCACCGGAAAGCGAGCAGACGTCGTCTGATGCAGGAGCGTGACCATGCACTGGCGGGCGTACAGAATGGCCAACGTGTT
CTCACATcttcgaagctgctcaaTCAGGCCTCTGAGGTCCAGCTGGTTGGTATCCGTCTGGAAATCCTCGTCGAATGCTGAGCGTGGCGCGTCCGGTGAA
TTGTCAGCGATGGGATGTGGTGCGCTTGGTGCTTTCATTTCCAGTGCGTCGGCTCGCCACGAACACATGAACCGCGACTTGGTGTTGGAGAGGAAGCCCC
CGTCCTCAAAAGGGAAGTACATTTCACCAAAAAGCTTTCGCCCCATCTCTTTACCGTTCAACGGTGGTGCCGTGCCGTCGAAGCCAGGCTCGGCTCCTGG
TTTGACAGCGTTCGAGGGCGAGTCGCCCGTTGCCTTCTCTTGGTCAttctcgctcgagctgaTCGAGGAATTCAAAGCTGGAGGCTGGGGAGCATCGTCA
GGCGGCACGAcatcgtcctcttcctcatcgAAACGCGGTGAATCTCGCCCCTTGTCGCGCTCTTTGTCCAGGGTGGATTGTAGTTTGCTCAGATACTCGA
GATTGTCGACTATCCAAGCGGACGCACTCACAATGTCGTTTTCCGTCTGCTTCAGTGCCAGCACACACCAGTCTTCTGGGAACCCCATGAGcatgagctc
ctccacaAACTCGGCTCGggtttcttcgtcttcgtcgtcgtcctctaaatcttcttcgtcttcctcgtcgtcctctccttcgtcgccgtcctcgtcgtca
ccttgGTC