Description :
From Genome Similarity Track
Location :
Scaffold_173:123948- 125221
Transcript NameFunction/comments
Hyaar_Emoy2811876hypothetical protein
Hyaar_Emoy2811877phosphatidylinositol kinase putative

Sequence
1273 bases(100 bases per row)
CGAGGCTATCCAACCAAGTCGTCTGCAGACTGCACTGGCTGAGAAAAGGAAGATACGAGGATCAGATCACAATCAAGTGTTGTCACGGTGCCACAACGGC
CGACTGCTTGTGTCTCAACTGCATGAAAAAAAGCTCGTCGGATGCCAGGGACCCTGGTGGTGCTCTATACATTTCTTTCTTCGTTGACCTGCGACGCTGA
AGCAGTCAGTCGTGACGACTGACTGGCCTGAAACCAAAATATCGTATTGTAAAGTAGCATTAAATCATGTATTAAAAACGTCACTATGAGTCACCAAAGC
ACGACCGCAGCTGCCTCTAATCAGGCACATACATCGTCCACTATTGACCTATGCTGCTACCGTCGACGTCCGACGCTGTTTACGTCTCTTCTTCTCGGCC
TCCTCGTCCTCTTCGACACCAATCACGTTCACCTTCTCGTTCACCTCGTCGCTCTTGTGTACATCCACTACTGCCGTCGACGGCACCAAGACCGCGCTCT
TCCGCTTCAAGCTCTTTCGAGCTTCCGCTCGAGCTGCACGTTTATCAATTTCAAATGCAAAGCCCACAGGCGTCGTCAGCTTCGGCCGTCGAACGGCAGG
GACCCCGACCCCGCCACTAGCGGACAGAGCTCTCGAGAACTGGTCACTCTTGCCTGGAGCGGCTCCGTGCGTCGTCGCATCGTGATACTTCTGCGTCTTG
CGTTTCTGCGCTTGCACCCGTTTACGGATCGCAGCAATCTCCAGGAGCTCTCGAGACGTGCGCGTCAACATCTCAGCACGGGAACGGGGTGTAGCCATCT
TCAATGGCCGAAACTTGGGCGACTGGGGGATGGTAAGGCGGCCGTTTTCCTTGGTGATCCGAGTCAGTCGACGCCGTTTCAGCGCCTTCTCGCGCGCCTC
GGCCAGCTCCTTGTCCTTCCCTGTCAACACTTTCTGTCTGGAAGCTGCGAGCGACGCCTTGGTGGGCCGTAACAGACGGTCCGACGATGATATGGCGCGC
ACCTTGGCAACACGAGGGGGAGCACCTCGATACAAAGCGTTCGGGTCGTCTTCGACCGTCGAGCGAGTCGTGGGGGGCGTCATAGAGGAAGTCGTGCCGC
TTGTATCCGTCGGTGGCGCCTCTTTTTTTGTTTCGTGAATGCCGCCGCGGATAGATGGCGGTATACAAACAGCAAGTGAAAGGACTGTCTGGGCGGTGTT
TGAATTTAAACTGAAAGCGGGATATCGACCAATGCAGTGGGAGGTTTGTGAATTGTTTATTTTGCACCAATCA