Description :
From Genome Similarity Track
Location :
Scaffold_14:123946- 132979
Transcript NameFunction/comments
Phyci_90913Hypothetical protein

Sequence
9033 bases(100 bases per row)
TCTACTCGGCACCAGGACGAAGCACCTTCGTGGGACGCACTGCTGCAGAAGCAGAGCCCTTGAGCACGGCGTGCTTGCGCTTGCGGAGCTGCTTGGTGCG
GCGCTTTTGCTCGTTCTTCTGCATCCGCCGCTGGGCCGCGCGCTGCGGGTCAGACACGGCTTCAGTGCGACGTTGAAGCTTGCGGGAGGCTCGGCGCGCA
GCCATCTTCCTCTGCACAAATGAGTACGCCTCCAAGAACGGCGTGGCGCCGAGCTTGTTCTCCAGAAGCTGCAGCACCTCCTGCGCCAAAAGTGCGCTCT
CAGGCGGCGTGACAGGCTCCGGAGCCGGGCCACTTCTCCGGTTCTTGTTGCGGTTGCGCTGCTGTTGCTGCAGCATCACCTGCTCCTGCTGAGCCTGCAG
CTCCTCGAGCTTGCTTGTCGCGCGGTACAGCGGGTTGATGATCTGGACGACGTACTTCTGCGCGAACTCAGCATCGTGGCCGTGAAGCAGAGCGGCAAAC
AGCTTGAACACCACGGCCTGGACTACGGTGCTGCAGTTCGAGCCGCGCGCAACATACGAGAGGCGCGTAAGCAGCCAGCCCATAGGAGTGCGCGACTTGG
CACGTtcctcctccttctcttgctcctcgcggtgctgcagctcagcttcatcctccttctcgtcagtctgctcctgctctgcgtcttcttcttcagcagc
cgccgccgcagcagcagcgtcctccaacaagtcaccacccaccacagcagcagcagcagcagcCGTCACATCTTGCGGGATATCCGAGTTCTCGAGCGCC
TCGCACAGGAACGGGAGGGCGGTGAGCACTTCGCTAGCCAGCTCTTCGTTCAGAGCTGGTGCTTCCAGCAGCTTGCAGAACGCGCTTGCCCAGCTGAACA
ACCGGCCAGGACGCTGGAGGTACAGCGCACCATTGCGCAGGCGGTCGAGGATATCGCCTGGAAGACGCTTCACCGGAGCTGCAAAAGCAAGCGTGTTGGC
TTGTCGACGGCGCAGATACGACGTCAACAAGCGGGTCGCGCCAAGACGCACCCACGCGTGAGGGTACTGCAGCAGCGGCAACACGACAACGTCGACAAAG
TTCTTCGTCGGCTTGGACTCCTCCAGCCACATCTCGTACGGTCCAGCAAGGTGATCGCTGAAAGCGGTGAGTGCCACGCAGACATGGTACGTCGGCTGCC
ACCGCACCTGGCTGTTGTCCTCCACGATCTGGAGCTCGCGCAGACTGCGCTCAAGTGCCGTGCGCGTCGCGGCAAGAACCTGAGGAGCACTGCGCTCGAA
GAACTCGGGACGGGTCTCCAGTACCAGCGTTGTCACCTGCGCAGCAGCTCCCAGAAGCTTCACTGCATCTGCCGCCTCGGAACTCGCAGCTTGCGTCCAC
CACGTGCCCACCAGCAGGATGCTCTCGTTCAGCTCCTTGTTGCCCAGACGACGCACCAGAGTGCTCAAAGCTGCACAGGCAAGGTCACGGCATTCAGAAG
CCTCGTCATTCGCCAAACGCAGCACCAGCGGCAAGAAGAAGAACTGAGACCGAGCGTTCACCAGGTCCTGCGGCAGCTTCGAGAGAAGCGAGCGCAGAGC
CTCAAGCACAGCAGAGCGGCCCGTTGCATGTCCGTAGCTCAAGTTGTCGACCAAGAACTTCAGATGCCGAGACAGTCGCTTGTTTCCAAGAGGATACTCG
AGCAGGAAGGTCTGGTAGATGGTTGCGCAGTTTAGGCGCGCACCAGGAGCATCGCTCTGCACCAGCAGCTCGCCAACACGAAGCATCACGTCGTACACCT
CGCTCACCACAAGACGCGAGTTCACGATGGCCTTCAGCAGAGCGAAGGTGGCATTCTGGTGGTCTTGCTCGTCCAGATCAGCACGCAAGAAGCTCAAAAG
CACACGCAGCTGCGGTTCTGTGAGTCGGAGAACATCGGTCTTGGAATCCTTCGCAGCGTTACCGTTCACCTGAGCGAGTTCGAGTCCATGTTGCTGTCTC
AGCAGAGCAGTAAGCGTACGGTAGCACGTTTGCACCATCTCGTTGCGAGTAGCAGCTCCTGCCTGCTGCAAAATCTTAAACAGGCGATCGAGAAGCGGTG
AGCGAGCTACACGCAACGCCGGGAGTTCTTCCTGTCGCGGAAGGAGCGATCCAAGACACTTGAGCGAGGTGATGACAGCGCGGTCGTTCTTCGACTCACC
CGCACAGCGCATCAGCAAAGGCACTAGCGGGTCGACAAGCTGAGCGGGAGCGTTTGAAGATTTCTTGCCGTTCTCGTCCTGATCCTTCGCGTTGCCGTTC
TTGCGCAGGAAGGAGAACACCAAGAAGACAGCAAAGTTCAGCAGTTCGCGGAGGTGAGCCGTGCTCTCGGCCAGAAGTGCAGCAATTTCCTCGCGCTTCT
GTTTCTTGGTCTTGCTCTGCTGCTGCTGGCGCATCTTGTCGAAACCAGTGACTTGCTGCTGCATGGCGACGCGGACAGTGTCGCGGGCATTTACTCGGGT
CGCAAGCAGCTTCGTAGCAGCCGCACTCTTCTCTGACACGAGCCACGAAGTCACCAGAGCAGTGCTGCTGCCTCCCGATTCGTACTGCTCCTTTTCCCTC
TCAGTAGTAGGGCGCAGACTATCGAGACTAGAGTTGAGAACGTTGTACGCGTACAGGAACATGTAGGACGACTCCACAGATGGGTTCTTGGCCAGTCCAA
TCGCCACGCGCTTCAGGCCCTCCTGTAGCGCTGCCGTAGCTTGAGCGCCTGCGTCCGTGGCCTGGAAACGCTTCACAAGCGCGCTCACCACTTCGTGGAT
ACTCGGGTTGGGCAAGAATGGCAACGATCTTGCCAGCAACTCCAGCGAGTCCAAGCTTCGTCCACCGCTAGCACGAGCCTCCTTCATCTTGGACTTTTGT
GCCGACTTGCGCTCCACGCCGCCAGCAGCAGCCTCAGCGGCTTCACCGATAGTCGTCATGCCCTGGAACAGCTCTGCTGCCAGGATTTCCATGAGGCTTG
GCACACAGGCATCCAGCGGTGAGGCAAATTCGGTCTCGTGCTGAGCCTCCTGCTGTTTGTCCTGCACAAGCAGCAGCGATTGAGGCTTGCGAAGAGAACT
TGCTTGTCCGTCCACGTGCATGATCTCCGGCAACTTCTCCAGCAACGCGTGTACAGTGAAGGACAACACGTGAACCATGTATCCATCGCGCAGAGTGTGG
CGAAGTTCCTCAACAATCGGTAGAAGGAAGCGGGCACCAAGCTCCACAGCAATTCGGACGAGCGTAGTGCGGGCGGACACACGGACAGCTTCGTCCTTGC
TCTTGAGCAAGTTAGCAAAACGGAGCAGCAGCTTCGGCAATTCACGCTGGAACGTCTCGGCGCGCAGTCGGCGCAACACCTTCACCACCGCCAGCGCGAG
GGGCACGCGCACCGACACAGCTTCTTCCGAGACTGAGGTCGAGTCGCCATCGTTGTCCTGCGACTTTGAGTTCTTCTTTGACGCAACTCCCTTGAACAGG
TACGAGTACAGCATCGGAAGAACCTGCGTCTCCATGTTGTCCTGGACCTTTGAAGAGCCATCCTCATCCTTATCAGCTTCGTCCTCCTTCGTTTCGTCCT
TTTTAGTACCGGCCTTGGACGACTGCCACTCAGTAGCCGCACCTGGCGCCTCGAAGTGAAAGTGGTCAATCACTGCACAGATGGACATAATGATAGCGCC
CTCCATTTCAACATGTCCGTCGATTGACTTCAGAAGTCTGCGAAGCAGCGACAGGTAGTGCGACCAACCCAGAAGACCAGCGGCACTTCCCACGCAAGCT
GCAGCTTCAGCACGGAGAGATTCCTGGCTCTTGGCGTGGGTCTCGTAGACGAAGTGCATCACCAGAGGGAGGATGACTCCATTCACAGTCGAGTTAGAGA
ACCATTGAGGCTCGTCATTCTCTTCACCGTCGTCATTATCCTGGGCTATAGCGGCCATCGAGTCCATGAGAGCACTCAGACGCTGCAGAGCACGACGTCT
GCGGTGAGCCTGGATGTGCGTAATGTTATAGAAAAAGTCGGCTTCGGGGTCCTCTTGGTTGCGCGCCAGTATCAAGTCTGTCGGAATGAACGCAAGCTGC
TTGAACTCCTTGTGCTTATCCGCCAGTGATCCAAGCAGCGTCACAAAGCCGCGCCGCGCATTTTCGTCGGTCGAGCGCAAACTTGATCGCACGCATGGCA
TCACCAGGGACTCGAGCGCATTGAGCAGAGGAGACTTCGCCGCATCCTGTCGCTCGTTCTGCTCCACTGCAACATCTGCGGCGAGTCCCAAGAAGGCCGT
AAGCGCAGCAAGCGCACCGCTGCGCACTGAAAACTCGGAGTCATGCATGCACTGCAAACATTGCGCCACCAGCGGCGCCAGCAGATGAGTTTCGTTCGTA
AAACCAGCAAAGCGCGTGGAGTTCAACCGGTTCAGCGCCACAAGCCGGCGCTCATAATCCGTCTCCTCGATATGCTTGGCATCGTAGGCATTGAGTTCAT
CCAGCAGCTCTGCTACAGGAGCCAGCTCCTTCAGCATACGGTGTCCACCCAGAGCTTTAAACACCAGCACGAGTTTTAGACGAGGATCGCGGTCAGCGAT
GCAGTTCGGACCAGGAGCCAACAAGCGCGCGAGAGCAAGCACATGCTTCTTAGGCTCCGAAAGCTTGGGAACCAAGTGCGCCAAGACCTCCAGCAGGTTT
TCCTTATCCTTAGTCGAAGTTTGATGGTTGCGCAGCAAGAATGGTAGAAGCAACTGGAACAGGTCGTGTGCAGCAGTAGCCACATCTCCCTCGGAGACAT
CCAGGTGATGCGAGAGACGACACAGGAACGTGAGTTCCTTTCGCGATGATCCCGCATACCGGTCACTCGCATAACGCGCGGCCTTGGCTTGGAAGCGCTG
CACAAACTGCTCCAGCACGAACGGAATATGGGTCACCAGCAGTAGCTTCTCTTTCGTTTTGGATGCAGCCATTGACTCGTCTCCCGACAGTAAGTGTTCG
TCTCCATCAAGCAGCGAGTCCATGAACTGCAGGATCGAGTCCAGGATCTCAGGAGAAATGCCACGAGAGGCTGCGGACGTGCTCGAAGACGCCAATCCAG
CTGACAAACACGAGATGACATTTAGTACAAGAGGCTCCGGAACCCACTGACGCACTCTATCAGCGCGGCCCATCGCCACAAGCAGTTCCAACAGCGCCGA
TGCCTTGCCAGCACCGACAACAGCGTTGGGCAGGTGAACAATGGCCTCCCGTGAGGTTTCCAGCACAGATTCCACCCACGGTTGGAGGTGGACAAGGGTA
TCAAACTGCAGTAAAGAAAACATAATAAAGGTTAACGTCGTCAAATGCGTAACACAAACGAGAAAAAAAACTCCGTACCGTGTCAATCAACTCTGCCAGT
CGACGATATGTCAACATGCGGATCTGCTTCTTCATCGAAGCAGAAGTTGCCAGGCTATCCACGTTTGGTGAAGTCTCCTCGGCCTTACGCTTTAAGCCGA
CAGCAACTACAGTGTCATCTCCATTTTCTTCGTCCTTCTCGTTGTCGTCGGCAGCTTCCACATCTTCGTCATCACCAGCAGCGATACTAATATGGAGAAT
TGCCACCAGCACGTCAGCGATCTGAGGAATAAAAGCAGCCAATTTCACTCCGAGTTGGTTGATGAGATCCTCCAGCAAGTTCAAGAAACCCAGAATGCGC
GAGGGCTGCACGCTAGAAACAGCAGACACAGGCGTAACTTCACCGACTGCAAGAGCGCCCTTGGGAGCTTCAATTTTAACATCAAATGCCCGCACCACCA
GTTCCACAAAGCTGGCGAGCTCAGGAGCCTCCAGTGCTGCCAGGTACGCTAGGATAGCCGCACGTCGAGCGGCCACAGTGTCGCCGTTGTTACGACCCTT
CTTGCTCACGCACTTGGAGTACAGAAGCCTCAGCAGCACAGGCAGCAACTCCGGACGGTGCTCGCGCAGCACAATACCCTCGCCATCTCCCACCTTAAAA
CTCGCCAGCTCCTCGCGGAATGAAGACGAGTCGGTCAGTCGGTTCAGTTGCGTCTTGTAGGTCACAAGAGCCTTGCTGCCGAAAGCGTACAGGCACTGCA
AAGCCAGCTTCGACACGATTTCATCCGACTTCATCAATAGATCGAAGAAAAGAGCATGCAACAAATGTTGCGCATATGCTCCCTTCATGTTGTGGAAGGT
GGTGAAAAGTTTCAGTTGGTCCACAAACTTGCCACGCACTTCCTTAGTAGTCAAGCCCTGAAATTCAACCGGTTTGCGCCAGGCAGGAGAGTCGGCGTCG
CTGGTCTCTTCGAGCTTGGCAAGGGCCTGGTCAATCTCTTCGAGCCTCTTGGAGTCAAGCTCGTCCGTGTAAATAGCACTGTATTGGTCGCGCAAGAACG
TAAGGAAGAGCGGCACCATGAACTTCGTCTTGGCCTCCACAAGGTCGGCAAATTTCATCAAACCCTTCCACAGCAGAGAGTGGTGAGTGGCAGCATCAGT
CACGCTTGCAGCCGAGACCACTCCCTGCTCCAGCATGCACACACGATGGAACTCTCCAACAACCGCACTTTGGTTGTTGAGGTCACTATCTTGCTTTCCA
TTCTGGTCTTCGTGACGGAGGGACGCAACCAGAAGCTCCGCGCTTATGCTTGGCCAAAAATCGTTGAAGTGCAAACGCGACGCAGTCTCCATCGCGTCAG
CAATATGCGGCCATATCGTGGAGAACTTGACGTGATACAGACCCAGCAACTGGTTCACGGCAATTTTCTTGTACAGCTCTGGAGTTTGTGGTGACTGGCA
CAAAATCTTCACGCGCGTCAGCAGGCGCACCACCTCACGCTCAGTAGCCACTGAAATGTCTTTGCATGCAAGCTCCAGGTTGACGCAAATGTCCGGAAGA
TCACACGGGCCACTGAGGGAGCCGCTGTCAGATTCGATAAAATTTGAGCGCTTGAATCGAGCCAGCAACTGAAGTGCCACCAAACGCAGAGCAGACGCAG
GCGAACGCAGCGTTGCCAGAAGGGGGTTAGCCACACGGGGAAGAGCTTCAACTGTCAGCACTGCGTGCTGCTTCTCCTCAGGCTCCATTTCAACGAGCAT
CAGCAACGTTGAGAGCGTCGTGAATGAAGACTCCTTGCCGAGGAGCGCCTGCTCTACATACTTGGTTGTAAGCGCCGAACCCTTACTCTTGCTCTGGTGT
TTGGCAATCTGCTCCAACTGCCACAATTCAGCACGCAACGAAGCAACCTCGATAGCCAACGTGCACGACTTGTCTTTCAACTGCTTATCACACTTTGCGA
TAAGTGGCGTAGTGAAGGCAGTCAGCTTGGCATCGTTCAACTGCAACAACTCCAACGCCTTGCAGAACTTCCAGCTCCGAGCCAGACCCTCCACGTCCTT
TTTGCTGTCGCTCTGCTTGAAGATCTTCTTGCCAGCGTCAAACAGCACCTTGTCGGCGCTTCCATCAACATCCTCAAACGAAAGCAGCCAGTAGCGACGG
TTGTTCTGTGATCGTACAATATACGCGCTCTGGCCCTCATTGATTTCTCCGGCGTTGTCGGCAACGTAGTCACCCAGCTGACACACCAGCGAGCTGAAGG
CCCCCACATCCGTCTTGAGGAGAGTCTTCAGCGCGAACTCCAAGGCGCTGGGGATCAAAAACTCCACGACAAAACCCACGTCGACGTGCGCGTTGTGCAG
CGCCTTGTCAACGAACTCCAGGAGCTTCTGGCGCCAATACTCCTGCTCGTCTTCGTTCGCTGCCACGGCGAAAATGGCCTTCACCTGCGCCGAAACCACG
TCGTCTTCGGCGGGGAAGAGCCTCCACACCGCCTCCAAAGTCTGCATAAGCACATCTCGCAGCGCATCGTTGTGCGAGGTCAGCACCTGGTTCTCCGGCG
CCACCAGCGCCGCGCACACCTTGTGCACGCCGGGCACCCGCACTTCGTACGCGTCGCTCGCGCCCGTCAGCAGTTTGCCCATGCGCGAGATCAAGAACCC
AAGCAGCACTCGCAGCACGCGGCTCAGGTACAAATCGTCAGCCTCCGAGGGCGTCTCCTCCTTCTCGTGGCGGATGTTGGCCACCTTGTTCACCACGAGC
ACCAAGCACTCGAGCATCTCTCCGGAGTGATCCGCGTCTGTGTGTTTCATCATGAGTCCGCAGGTCTGATAGACAATCTCAAACACCGCGTCGCGCTGCT
CCAGCTGCTCCTGCGTCTCCTCCTCCTCCTCCACCGCCTTCTTCGGCCTAAACGCCCCCAACAAGTACAGCAGCACCTCGCGCATGCGCGAGTGGAACCC
GTGGTTCACATTCTTCACCAGCGCGAAGAACAGCTTGGCCGAGCCGTCCCTCAAAACCTCATTATCTCGTCCCGACCCTTTCACGAGGGCCGTCAGGTAC
GCGCCCAGGTACTTCCGCATGGCCTTGACGGACTCCAGCCGCCTGAGCAGCACGGCCAGCGTCTGCGCCGCAAAGTCTCGGACGAACTCCCTCGGGTGGC
CCAGCAGGGGGAAGTAGCACTTGTGCACGGCCTCCATGTCCGCCAACAGCTGCACCCGCAGGTGCGTGAAGAGCATGGTGAGCGTCTTGAACGCCTGGGT
GCTGAGCTCCGGGTCCTTGGTGTCGATCACCGCCACGACGTGCGGCAGCACCGATGCAAAGTGGGGGTAGAACTCCTTGCGCAGCTCTCTGCCCAGCGCC
GCGACCAGCCTGAGCACCGGCACGAGCCGCTGACGCAGCACCACCGGGTCGCTCTCGTCCTGCTTGGCCTGCTGCAGCTCCGTGCGCAGCGAGCGCGCAA
CCTTCTTGAGGTGGTGCAGCAGCTGCGGCGTCGTGGCCACCAGCGGCTGCAGCGAGCGGAACAGCAGCTGGAAGGCGTCGAGCGTCGTGAGCTCCGCCTG
CAGAGCGAGCTCCTCCTTGAAGGACAGCGCGGACGCCTCGTCCACGGCGCCCGTGGTCTTGGCGTGCAGCGACAGTTCGTGCTGCAGGCCGCTCACGCGC
TCCTCCACGCGCTGGAAGCGGTGGCGCCGCTTC