Description :
From Genome Similarity Track
Location :
Scaffold_282:123935- 125017
Sequence
1082 bases(100 bases per row)
AGCGTTGGGTGCGTGGCTGCCAGGAGTGTGGCAGTCGAAAGGCTAAACCGCGTGATGTGGTACCACCCTTGCGGAGTATTAGAGGAGGTGCAGTCGGAGA
TAGGTGGGCTTTAGATGTGGCTGGCCCCCTGCCGGTGGCCGACGGTGGAAAGAGATACGTTATCGCGGCTGTCGAGTATGTGACTCGCTATGCGGTGGCG
AAAGCGGTCGAGCGGCACACGGCGGAGAATGTGGCCAGGTTCCTAATGGAGGAGATTGTGCTTAAATTTGGTGTATTTCGGGAATTATTGACGGATGGTG
CGCCGGAGTTGACAGGGATTGCGATCGAGAGGTTGGTAGCAATGCTGCAAGCAGAGCAGATCAATCCGGTGCCGTATAGGCCTCAGATGCTCGGCTTGGT
GGAGCGCTTCCATCGTACATGGAAGGATTGTGTGGCCACGTATATGCAAGCGGACGCCCAAAATGACTGGGCTACGTGGGTGCCCTTCGCAGTCTACGCC
TACAATTTCGGCAGGCATTCGCCGGTGGCGCTTTCACCAAATGAGTTAATGATGGGCAGGCGGTTAAGGAGTTTAAACGAGTTGTTGAGTGTGAACGGCG
TCACGGAGGTGGGAGAGCTGTCTGTCTATCATAAGCAGTTAGTTATGGCGATGCGCAAGAGTTACGAGGCAGCGGAAAGTGCACGGGAGCGTGAGCAGCG
CCACCAGGCCTCTTACTACAACCGAAAAGTGAAGAACCGGCGTGAATTTAAGCCAGGCGATCGGGTGTGGATGTACCGACCGCCCCGAGGACCAAAAGCA
AGTAAATTTGTCCACCAATGGATGAAGCCGATGAAGATTATTGAACCCGCAGGGTTTGAGAACTTCTTGGTCAAACGGGAGGATCAGAACGGGGAACCCG
AGCGATTTATAGCTCACTTGTCTTTCCTAATCACCTACTATTATCCGGTGGACTTGCTGAAACGTGTGGCGGCAGACATTGCGGCGCAACTGGAGTATGA
AAATTCGGGCGAGTCACGTGAAGATGTACAGCCAGCAAGACCGACGGCTGGATCAGCGACGGCGCCTGCGCAAACAGCAGCG