Description :
From Genome Similarity Track
Location :
Scaffold_2330:1239- 2760
Sequence
1521 bases(100 bases per row)
CTCGACTTCATATTCACCGGCAACTTGATCTGGTTCCCAGCTGTCCTCAGGCAGTAGCTCCTCATCGAAGTCGAGTCTTGCTTCATTAGTCGCGTCAAGT
ACCAACCGAGTGTTCGGTCGACTGTTGAATTCGTTGACAGCCTTGAGTCTTGACACATGCACTACTGGGTAAAAGCGATACCCACTTCGATCAGGCAGTT
CCAGCTCGTACGCAAACTCTCCCACCTTGCGCTTGATCCGAAAAGGTCCATGCCATCGGTGAGCTAATTTCTTCGTCAAGCCCGGTTTGACGCGTTCCAT
GTACAACCACGCCCGGCTCCCAATCTCAAAAAGAGATCTCGGTGGAGCTCTTGCAGGATCTTCCATCTCTTCCGAAGCTTCTGGAGGGTTCGCCGAGTGT
TCGTTTCCACTTGGTTGAGGTACAGCAGCTTTTTCCAGTCGACTCAGGGCCTCATTATGCTTTTTAGCCCTTCGCTCCTTTTCTACAGCCTGATAATCTT
TGGCCATAGTGAGGGCGACCTCATGTTGTCGATTGATCTCGCGCCGCACGCCAGTGCGTCAGACTGCTTGCCGAGTCCTCGTTTGAGAGATGACGACATT
GCCCGCAACGTCGACTGCGCATCCCAACCATGAACGAGATAGAACGGTGTTTTTTTTCCTTGTAGTGTCCTGAGAAGTATTAATAGCAAACACCAGCTTC
TCTACGATTTCATCCCAATCTTGCTGTAAAGGGTCTTCCGCGTACACCCGTACGGAACCCATCACTGACTTCACCGAGCGTTCCTGCTGTCCATTAGCCT
GTGGTCGATAGCTCAAAGTCGCCCGTGATCTTGACTGCATCATCTCTGCGAACGCTTGGAACACCTCGCTCATGAAGCGTGGGTCACGGTCGTGCCTTAT
CAGTGATGGGGCTCCGAACCGTCGGTACACAGATTCTTCGAACACTTGGGCCACACTCAGTGCAGTCGTATCCGACATAGCCTTGTCAATAACGAATGTT
CTGAGCGAGCACTGAAATAGGAGCAACGCCGTGTTGCCCCTGCGAGATTTCGGTAGTGGGGATCACAAAATCCATCGAGACGATCTGGAAAGGTCGTTCG
GCTAGTACGTTGCCAGGTGAGTATCCACGAAGCTGCGGACAGCTTTTACTCGAGCTGCAATCTGGACATGACTTCACATGCTTCTCCACGTCAGCGTACA
AGCCGATCCAATAATAATCGGACTTAACGCGATGGAACGTTCTCACCACACCTTGATGTCCTCCTTCCAGCGAGTCGTGACACTTCTGCAAGACCTCTTG
AATCATCGTAGTTGGTACCACAAGCCGCAGCTTGGTCTCCTCTTGCCAACCGTGGTCGTACCGACGATTCAATCCAAGATAGTGAAGCACGCCGTCTTCT
GATAACACGAACCGGTCAGCGTATTTCCAGGCATTTCGAGCTTCTTTGTAACTCAGCTCTTGTGCTTGGCCCTGAAGCACCTTCTTGATGTTAAACCACT
TCTGCTCCTCGTCTTGTGCCA