Description :
From Genome Similarity Track
Location :
Scaffold_23:123892- 129072
Transcript NameFunction/comments
Physo_132882hypothetical protein
Physo_132883reverse transcriptase

Sequence
5180 bases(100 bases per row)
AGAAGTGTGCGGGCAATTCAGCGATCTAATGAGCGTCACTGCGCACCAATGGTATCTCCAGTTGCCCAGGAAGGTCAAGAAATCATGGACCGAGCTGATG
GAGCAATTCCGTGTGCAGTACTACGGCAAGGGCGTGTCAATGGCCAGCCGCTACTATCATGCGGCTCAGCGCCCCGACGAGACCCCTCTGGATTACTTGT
ACCGGCTCAACGTCGTGGGCTTGAGGGCCAACATCCCATACGCCGAGGGTACGTCGAGCATTTCATCCGGACGCTGAACACGCAGGAGGCCGAACTCGCC
TCGCGTCTCGCGCTGATGGAGGTCGCCGACTCCGAGCCGCTGGAGAAGAAGCTGCGTGCCCGACAACGGGGACTGGCCCACCAGAAAAAGACTCTCTTCG
GCTCGAACAAGTTCCGCCAAAAGGCGCCGACCCCGCCGGCTCAGCCGGTGCGCGCCGTGGATGCGATTCACGTCGCGTCGGACGAGTACGATTCGGGACG
CGAAAGTCGCGACAGCGACGATCGCCAGTACGACCAAGACGAGGCGGACGAAGAACGCGCCAAGTTGTTCGTCGCGGGACAAGTCCCGCCGGGAGAGCCG
GCGCGTCGCAACTTCGATCCCGACGACTCGGGACGCGACCGCCCGCGGTGCCGCCACTGTGGTTCACGTCAGGAGACTGCTGGAAGTTGTTGACGTGTCA
GAAGTGTGGTGGCCAGCACCCGACGGAGCGATGCTTGAGGGTGTGCAAGGCCTGCGGTGACGTGCACGAAGCCGGAGAATGCCCGATGGAGGAGTTCTTC
AACCAATTGTGCCAGTGGTTTGACTCGAATAAACACGCGGGAATGCTGCCGCCGGCCGCCGAGAAGATGTTAAACTAGGACGCTCGCTGGCTTGGAAACC
AGTACGAGACGAGAGACCTGTTTCCGTCTATGCATATGTGACCAAGAAGTCACGAGAGGTGGTTAGTGAGAGCCCGACTTCCCTGAATGATAATACATGT
GAATCCAACCTGGAACGTACCACGCAAGAACGCGCGCGGCGAATCTCGGCGGTCCGACGTACGACGGACAACGAGTTTGCACGTGAACCACCCCTGGACG
AGATCGACTTGCAACCAGGAGAGCGACGCTGATACTGGAAACATTACGCGCCGCACAAGTGGTACAAGCAGGCCAAGATTCATGGAAAGCTGAACAACCG
CCGTGCTGTGTTATTGCTCGACACAGGTGCCGAGGTGTCCATCCTGGACACCACATTTGCTCGTGAGGTAGGCTGCCTGATTGACACGGAGATCACGCAA
GAGTGTGTGGGAATTTGTGATGAGACATATTACACGGTGGGGAGAACCAGAGTCAAGATTACCTTGGCTGAGAACTTGGTGTACTACATGCACCTGTGGG
TCGGCGACTTGGTCGGCCAACACGCAATCCTGGGAATGAACTTCATGGTGCCCGCTGGAGTGCGCATCGACACTGCGGACGGCACGGCGTGCCTCCCCGA
CGAGGTGCATATCCGGATGATCGGACGACGACCGCTATACGGCGCACGGATGCACCCGGTCAACGTCAAGACGCCTGTGAGGCTCGAACCAGCAGACACG
CATGAAGTGTTGCTGAGGCCGGATCGAAACGCGCCGTTCCTGTGGGTGAAACGGGCAGAGTCGTGGGTGACTACCTTTGTCAAGGGGAGAGTCAGAAAGA
AAACGTACCTGCGTGTCACGAACATCGGAGACGCAGCGATAACCCTCGACGCGCATGAAACGCTTGGGTGGTGGACGCCGTCTGACGGCCAGCCTCGGAA
CCGTGGATTCGTCCGACTGGTCTCCACCCGGTACCAGCAGTGGCAGAATCTGGCGTACGGCGCGACGCGGAGGAGAACTGGATCCCAGCCGAGCTCGACG
GACCGATGACGGATCGCCCCTCATACCCGACGCCTAAAGCCATCTTGCGCCCGGAGCCGAGACACCTCGGGACGCGACGCGCCGTGACCCCAGTGTTGGC
GGCTGTCGCGGAAGCGCCGAAGGGAAGGGGGTAGTCTTGCCACCCGGCGACCACAAGCCGGATACGGACGAGGATGCGGTGGAAAGCAAACCCGATATGC
CTCCGACTGTGGCTGGAAGCGCGGCGATGGAAGAATCGCCGGAGTCGGAACTCGACGAGCCAAAACTCGACGGACCAAACCCCGCCGAGCCGAATTTCGA
CGAGGCGAAACCTGATGAGCAGGAGGAAGACGACGCGGTTCTCATCCACGAGGGGTCCGACCTCTTCGTAGAGGATCTCGAGTCTGAGATGGCAGTGCTG
CCAGACCTCTCGCTGACCGCCGAGGTGAAGATCGAGGACTTGAAGGTCGGTATGCCGACTGGACTCCCGCACGAGGAAGCCGCGAGACAAGAAACGCGGC
TACGCCAAATCATCTGGCAACGGCGGAAGTGGTTGATCGGCAAAGGCAACGCCTTGCCGCCGGCCGCCCTGGGTGTTGTCTGCGACATCGACGTGGGCGA
AGAAAAACCCGTCGCGCAACGCGTCCGGAAAATCCCGCCGAAGTTTCGAGAGAAGGTCGCCGACTTGATCAAAGGGCTGCTGAGCGCGAGGATGATCCAG
AAGTCGAAGTCGCCGTGGGCGTCGCCCATTGTCGTGATCATAAATAAGAACGGCGTCGATATCCGGCTTTGCATTGACTACAGGCTCATCAACGGGCTGA
CACAGTTGATGATTTACCCCATGCCGCTCGTCAACGATTTGCTCGAAGACTTGGACAAGTATCTGTGGTACTGCTCCCTCGACATGATGAGCGGCTTCTG
GGTCGTCCCCATGACAGACCGGGCCCGGCTCATCTTAGCCTTCATCACGCCGATGGGACTGTACGAATGATTGCATATGCCGTTTGGCCTGTGCAACGCG
CCGCAGATTTACCAACGCTTGATCGACAACGCGCTCTACGGGTTCATGAACCTGTCCCCGGATGGCAGCACTCGGGACGTCTTTGAAGACGGCGAACCGG
TGAAGCCAGGTATTCACTTCATTCTGGGACGGAGGTCGTACATCGACGACATCCTCATCGGGGGCACGTCATGGGACGACCTGTGCGAGAAAGTCGAACG
CTTGCTGGATGTCAGCGAGCAGTGGCATTTGTCCATCAGTGTCGAGAAGAGCGAGTGGGGCATGTCCAAGGTCGACTACCTGGGCCACCGAGTCTCAGGA
CTCGGTCTCGAGGCGAAGCCGAAGAATCTGGAGTCGCTGACGTCGCTCGAATTCCCGCGCACGCTCAAGGGCCTGCAATCGTTCTTGGGTAGCCTCAATT
ACTACCACCGGTTCATTGCAGACTTTGCGGTGTATGCAACCGCGCTGTATTCGCTGACGGAGACCGACTTCAACGAGTACGTCACGCGCCCAGAAGTCCG
CGGGCATGAGAAGTGGACGCATGCGACGCGCCCCTTCGACGCGCTCAAGGCAAAACTTGCCGAGACCCCAATGTTGAACACTTCGACGCGAACCGAAAAT
CCGTCGTGACCGTGTACGCCAGCGACTGGGCCATCTCAGGGGTGCTCACGCAGGTCCACGACGAAGTATACATGCCTGTGAAGTTCACCAGTCGTACGTT
GAAGCCCAACGAGCTGAACTACGACATCGTCGAAAAGGAGATCTTGGCCTTGTTGCGCGTCTTAAACGAGTGCTACACGATGCTAGCAGGTAGACCAGTC
CGCATCTTGACACGTCACACGACACTCGCCTGGTTGTTCCGGTCCAAAGGACTACAGGGGCGACTGCCATAGTGGGCCGCGATCCTCTCGCCGTGGAAGT
TGGAAATCTGCCGATCCATGAAGGGAGAAGAAGAACTCCTCGGCGCGCTGGCTGCGAGCATTACCCCCGCGAGCCTTCGTCGACGCGGCGCTAGAAGAGA
TCGCCCCACGGAGACGGGCGTCCAGGATTGTAGTCATTCCAGTCCCTGACGTGGCGCGCGACGAGGTCTTGCACGTTTTGAGCTTTGATGATCGGCCAAG
GCGAAGCGAGGAGACGGAGCATACAGTGCCGTCATTTGGCAGCCGCCGAACTGGGAGATCGTGCGCGCCGCGTCGGGATATGCGACGGACCTCACGGTCA
ACGAGGCGGAATACCGCGGGCTGCTGCTCGGATGTTCTCTTCTAGAGGGACTCGACGACGTCACCCGACTCGGCGTATGCGGAGACTCCAACCTTGTCTC
TGGCAGATGCGGGTCGAGATGGACTGCAAGTTCCCGGGGCTGAAGCCGCTGCGACAAAAGACGCGAAACGCACTCCAGGCATGGCTGCGCCATAAACTCT
TCCACGTACGACGAGACTGGAACGCGAATGCCGACATGCTGGCTGGACAAGATCTGCAGCCTGAAGGAGGCCGCAACGCTCACAGCCCCGAAGAGATTCA
AGATCTGAAGACGCTGAATCGCTTGGGAGAAGTCATTCGACCACTGGCATCGAGTCCCGAGATGGAGTCTCCAGCCAGTCCCGACGCGGATAATCTCGAC
GCGAAAACACGCGGCGCAGATGACCCCGTCGGAAGGCCATGGACGCGGGACGCGGGACAGCAGAAGTCCTCGCTGTGACGACTCGCTCGGCTGCCGCACG
CACGACAACACGTAGGGTCCAACCTCCAGAAGTCCTGGAGGAGCTGGTGGTGCAACGACTGCGCCTGGACCGCATCCGCGTCGCCCAGGACGAAGAGGTC
TGGATCGTCAACCTCAAGAAGTATCTCCGCGGCGACGTCGGAGACCTATCTCGGCGCGAGGTGAAGAACTGCCAAAAGCTTGCGTTTCAGTACGAAGATG
GCGAAGGCGGGCTGCTCTACTACCAGCCGAGAAGCGACGATTCCGCCGAGGATCGCGATGTGATGATGAAGCTGGTGATCCCGGAGACTCTTCGGGAAGA
TGTACTCCACCACTATCACGCGAGCTTGGAAGGCGGACACCAGGGTATTGGCCGCACATACCAACGCGTGAGGCACCACTTCCATTGGCCAGGGATCTTT
AGAAGCGTCCAGCGCTACGTCGGCGAATGCACCGACTGCGAGACGGGAAAGGGTCGGCCGACCATCCAGGGCGAGTCGCCGGGCAACATCGTCGCGACGT
ACCAATTCCAGGTCATTGCCATGGACCATATTCCGTCGTTGCCGGCATCCTACAAAGGCAACACAGAGCTGTTAGTCTGG