Description :
From Genome Similarity Track
Location :
Scaffold_6:12389- 13418
Transcript NameFunction/comments
Phypl_g259myosin-like protein

Sequence
1029 bases(100 bases per row)
TGAAGACGAACGAGACGAACCAAAGTATCCTGGTGAGTGGTGAGTCTGGTGCCGGTAAGACGGAAACGACCAAGATCGTGATGAAccacttggccagcgt
ggctGGTGGCCGCAAGGACAAGACCATCGCTAAGGTCATTGACGTGAACCCGCTTCTTGAGTCATTTGGTAACGCTAAGACGACGCGAAATGACAACAGT
TCGCGTTTCGGCAAGTtcacgcagctgcagttcgacgGCCAAGGCAAGCTGATCGGTGCCAAGTGCGAGACGTACTTGCTGGAGAAGTCACGTGTGGTGT
CTATTGCTGAGGGCGAACGCAACTACCACATTTTCTACCAGCTCTTGGCTGGTCTCCCCAGTCGCGAGCGTAAGGAGTTTGGTCTTGACCCTGACTGCCT
GTACCAGTATGCTGGATCACTTGCGGAGATGCAGATCCCTGGTCTAGATGATGCCAAGTGGTTTGCAAGCACGCAGAAGTCGCTGTCCACCATTGGTCTG
GATGCTGGCGCGCAGAAGACGCTTTTCAAGATCCTGGCTGGTGTGCTGTTGCTTGGTGAGGTGATGTTCGACAAGAGTGGAGAGAACGGATCGCGAATTT
CGAGCGGTTCTGCGCTGTCGCAGGTTGCCAAGATGTTCGGTCTTCCGACGACGAGAATCGAGGAAGCACTGTGTAACCGCACGGTCATCACCCGTAACGA
CAGTGTGACGGTGCCGCTGGCTCCtgtggaggcggcggagaacCGTGATGCTTTGGCTAAGACCATTTACTCTAAGATGTTCGACTGGATGGTGGTGAAG
ATCAACGCTGCTATCAGCACCGACGAGAGCCGCATCAAGGGCCAGATCGGTGTGCTGGATATCTTTGGTTTCGAGGACTTCGTCCACAACGGATTCGAGC
AGTTCTGCATCAACTACGCGAACGAGAAGTTGCAGCAGAAGTTCACTACGGACGTGTTCAAGACTGTCGAGGACGAGTACATTCGTGAAGGCTTACAATG
GGACCACATCCAGTACCAGGACAACCAGG